EMAIL THIS PAGE TO A FRIEND

ZNF839

zinc finger protein 839

Synonyms: C14orf131
Gene ID:
Zebrafish(566882) zinc finger protein 839
Horse(100058451) zinc finger protein 839
domestic cat(101083346) zinc finger protein 839
dog(612606) zinc finger protein 839
chicken(423466) zinc finger protein 839
cow(616326) zinc finger protein 839
sheep(101121459) zinc finger protein 839
naked mole-rat(101722355) zinc finger protein 839
domestic guinea pig(101788536) zinc finger protein 839
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32906 Anti-C14ORF131 antibody produced in rabbit IgG fraction of antiserum human, horse
western blot pricing
HPA020434 Anti-ZNF839 antibody produced in rabbit affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018335 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075561 MISSION® esiRNA esiRNA human ZNF839 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018335 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351776 predicted 2882
2 SASI_Hs02_00351777 predicted 783
3 SASI_Hs01_00209015 predicted 1560
4 SASI_Hs02_00351778 predicted 1477
5 SASI_Hs02_00351779 predicted 1501
6 SASI_Hs02_00351780 predicted 1265
7 SASI_Hs02_00351781 predicted 780
8 SASI_Hs02_00351782 predicted 2252
9 SASI_Hs02_00351783 predicted 853
10 SASI_Hs02_00351784 predicted 1276
11 SASI_Hs01_00209010 predicted 903
12 SASI_Hs01_00209011 predicted 332
13 SASI_Hs01_00209012 predicted 515
14 SASI_Hs01_00209013 predicted 358
15 SASI_Hs01_00209014 predicted 1281
16 SASI_Hs01_00209016 predicted 1472
17 SASI_Hs01_00209017 predicted 899
18 SASI_Hs01_00209018 predicted 393
19 SASI_Hs01_00209019 predicted 572
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018335
ZNF839 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 839
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018335.1-395s1c1
Sequence:CCGGGTTCTGAAGAAAGCCATACAACTCGAGTTGTATGGCTTTCTTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018335.1-1162s1c1
Sequence:CCGGGACATTGTCACAGTGACTGATCTCGAGATCAGTCACTGTGACAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-1048s1c1
Sequence:CCGGGAAATTTCCAATGGGAGCCATCTCGAGATGGCTCCCATTGGAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-1159s1c1
Sequence:CCGGGAGGACATTGTCACAGTGACTCTCGAGAGTCACTGTGACAATGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-60s1c1
Sequence:CCGGCCAGGAGACCCTGGAAATAAACTCGAGTTTATTTCCAGGGTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-291s1c1
Sequence:CCGGCACTGAATCTCTTGCTGCCAACTCGAGTTGGCAGCAAGAGATTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018335.1-366s1c1
Sequence:CCGGCCCTCCAGTAAATGTGACTGTCTCGAGACAGTCACATTTACTGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-601s1c1
Sequence:CCGGCCTGGAGAGAATGCTTTGGAACTCGAGTTCCAAAGCATTCTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018335.1-1107s1c1
Sequence:CCGGGACTTCCGATGGGCTTATCTTCTCGAGAAGATAAGCCCATCGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-1062s1c1
Sequence:CCGGGAGCCATGAGTTACTGTCTCACTCGAGTGAGACAGTAACTCATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-403s1c1
Sequence:CCGGGAAAGCCATACAACGACGGTTCTCGAGAACCGTCGTTGTATGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-500s1c1
Sequence:CCGGCTATAGGTGCTGCTCTCTCATCTCGAGATGAGAGAGCAGCACCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-917s1c1
Sequence:CCGGGATCACTATTGACTGAAGGGTCTCGAGACCCTTCAGTCAATAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018335.1-97s1c1
Sequence:CCGGGAGTCATTAGGAATCACAGAACTCGAGTTCTGTGATTCCTAATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018335
ZNF839 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 839
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018335.1-395s1c1
Sequence:CCGGGTTCTGAAGAAAGCCATACAACTCGAGTTGTATGGCTTTCTTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018335.1-1162s1c1
Sequence:CCGGGACATTGTCACAGTGACTGATCTCGAGATCAGTCACTGTGACAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-1048s1c1
Sequence:CCGGGAAATTTCCAATGGGAGCCATCTCGAGATGGCTCCCATTGGAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-1159s1c1
Sequence:CCGGGAGGACATTGTCACAGTGACTCTCGAGAGTCACTGTGACAATGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-60s1c1
Sequence:CCGGCCAGGAGACCCTGGAAATAAACTCGAGTTTATTTCCAGGGTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-291s1c1
Sequence:CCGGCACTGAATCTCTTGCTGCCAACTCGAGTTGGCAGCAAGAGATTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018335.1-366s1c1
Sequence:CCGGCCCTCCAGTAAATGTGACTGTCTCGAGACAGTCACATTTACTGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-601s1c1
Sequence:CCGGCCTGGAGAGAATGCTTTGGAACTCGAGTTCCAAAGCATTCTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018335.1-1107s1c1
Sequence:CCGGGACTTCCGATGGGCTTATCTTCTCGAGAAGATAAGCCCATCGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-1062s1c1
Sequence:CCGGGAGCCATGAGTTACTGTCTCACTCGAGTGAGACAGTAACTCATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-403s1c1
Sequence:CCGGGAAAGCCATACAACGACGGTTCTCGAGAACCGTCGTTGTATGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-500s1c1
Sequence:CCGGCTATAGGTGCTGCTCTCTCATCTCGAGATGAGAGAGCAGCACCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-917s1c1
Sequence:CCGGGATCACTATTGACTGAAGGGTCTCGAGACCCTTCAGTCAATAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018335.1-97s1c1
Sequence:CCGGGAGTCATTAGGAATCACAGAACTCGAGTTCTGTGATTCCTAATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018335
ZNF839 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 839
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018335.1-395s1c1
Sequence:CCGGGTTCTGAAGAAAGCCATACAACTCGAGTTGTATGGCTTTCTTCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018335.1-1162s1c1
Sequence:CCGGGACATTGTCACAGTGACTGATCTCGAGATCAGTCACTGTGACAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143498    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-1048s1c1
Sequence:CCGGGAAATTTCCAATGGGAGCCATCTCGAGATGGCTCCCATTGGAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142569    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-1159s1c1
Sequence:CCGGGAGGACATTGTCACAGTGACTCTCGAGAGTCACTGTGACAATGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-60s1c1
Sequence:CCGGCCAGGAGACCCTGGAAATAAACTCGAGTTTATTTCCAGGGTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-291s1c1
Sequence:CCGGCACTGAATCTCTTGCTGCCAACTCGAGTTGGCAGCAAGAGATTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018335.1-366s1c1
Sequence:CCGGCCCTCCAGTAAATGTGACTGTCTCGAGACAGTCACATTTACTGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-601s1c1
Sequence:CCGGCCTGGAGAGAATGCTTTGGAACTCGAGTTCCAAAGCATTCTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018335.1-1107s1c1
Sequence:CCGGGACTTCCGATGGGCTTATCTTCTCGAGAAGATAAGCCCATCGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-1062s1c1
Sequence:CCGGGAGCCATGAGTTACTGTCTCACTCGAGTGAGACAGTAACTCATGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-403s1c1
Sequence:CCGGGAAAGCCATACAACGACGGTTCTCGAGAACCGTCGTTGTATGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-500s1c1
Sequence:CCGGCTATAGGTGCTGCTCTCTCATCTCGAGATGAGAGAGCAGCACCTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018335.1-917s1c1
Sequence:CCGGGATCACTATTGACTGAAGGGTCTCGAGACCCTTCAGTCAATAGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018335.1-97s1c1
Sequence:CCGGGAGTCATTAGGAATCACAGAACTCGAGTTCTGTGATTCCTAATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks