EMAIL THIS PAGE TO A FRIEND

ZNF83

zinc finger protein 83

Synonyms: HPF1 ZNF816B
Species: Human ZNF83(55769)
UniProtKB ID: P51522, A8MT75, Q3ZCX0, Q6PI08
Gene ID:
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018300 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018300 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018300 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU096861 MISSION® esiRNA esiRNA human ZNF83 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105549 Rosetta Predictions human pricing
NM_001105550 Rosetta Predictions human pricing
NM_001105551 Rosetta Predictions human pricing
NM_001105552 Rosetta Predictions human pricing
NM_001105553 Rosetta Predictions human pricing
NM_001105554 Rosetta Predictions human pricing
NM_018300 Rosetta Predictions human pricing
NR_003936 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324341 predicted 2259
2 SASI_Hs02_00324342 predicted 2300
3 SASI_Hs02_00324343 predicted 2305
4 SASI_Hs02_00324344 predicted 1989
5 SASI_Hs02_00324345 predicted 2224
6 SASI_Hs02_00324346 predicted 1008
7 SASI_Hs02_00324347 predicted 1088
8 SASI_Hs02_00324348 predicted 937
9 SASI_Hs02_00324349 predicted 745
10 SASI_Hs02_00324350 predicted 2306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324351 predicted 2145
2 SASI_Hs02_00324352 predicted 2176
3 SASI_Hs02_00324353 predicted 2191
4 SASI_Hs02_00324354 predicted 1869
5 SASI_Hs02_00324355 predicted 2113
6 SASI_Hs02_00324356 predicted 890
7 SASI_Hs02_00324357 predicted 963
8 SASI_Hs02_00324358 predicted 821
9 SASI_Hs02_00324359 predicted 626
10 SASI_Hs02_00324360 predicted 2196
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324361 predicted 2172
2 SASI_Hs02_00324362 predicted 2201
3 SASI_Hs02_00324363 predicted 2210
4 SASI_Hs02_00324364 predicted 1900
5 SASI_Hs02_00324365 predicted 2138
6 SASI_Hs02_00324366 predicted 918
7 SASI_Hs02_00324367 predicted 995
8 SASI_Hs02_00324368 predicted 849
9 SASI_Hs02_00324369 predicted 658
10 SASI_Hs02_00324370 predicted 2223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324371 predicted 2048
2 SASI_Hs02_00324372 predicted 2086
3 SASI_Hs02_00324373 predicted 2087
4 SASI_Hs02_00324374 predicted 1771
5 SASI_Hs02_00324375 predicted 2011
6 SASI_Hs02_00324376 predicted 789
7 SASI_Hs02_00324377 predicted 870
8 SASI_Hs02_00324378 predicted 724
9 SASI_Hs02_00324379 predicted 530
10 SASI_Hs02_00324380 predicted 2094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324381 predicted 2197
2 SASI_Hs02_00324382 predicted 2230
3 SASI_Hs02_00324383 predicted 2245
4 SASI_Hs02_00324384 predicted 1920
5 SASI_Hs02_00324385 predicted 2161
6 SASI_Hs02_00324386 predicted 1021
7 SASI_Hs02_00324387 predicted 1108
8 SASI_Hs02_00324388 predicted 960
9 SASI_Hs02_00324389 predicted 771
10 SASI_Hs02_00324390 predicted 2245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324391 predicted 1836
2 SASI_Hs02_00324392 predicted 1873
3 SASI_Hs02_00324393 predicted 1878
4 SASI_Hs02_00324394 predicted 1559
5 SASI_Hs02_00324395 predicted 1800
6 SASI_Hs02_00324396 predicted 664
7 SASI_Hs02_00324397 predicted 742
8 SASI_Hs02_00324398 predicted 590
9 SASI_Hs02_00324399 predicted 402
10 SASI_Hs02_00324400 predicted 1879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158644 predicted 1921
2 SASI_Hs01_00158646 predicted 1958
3 SASI_Hs02_00351705 predicted 1958
4 SASI_Hs01_00158647 predicted 1642
5 SASI_Hs01_00158648 predicted 1887
6 SASI_Hs02_00351706 predicted 665
7 SASI_Hs01_00158649 predicted 738
8 SASI_Hs02_00351707 predicted 598
9 SASI_Hs02_00351708 predicted 400
10 SASI_Hs02_00351709 predicted 1972
11 SASI_Hs01_00158645 predicted 1226
12 SASI_Hs01_00158650 predicted 1357
13 SASI_Hs01_00158651 predicted 1509
14 SASI_Hs01_00158652 predicted 2034
15 SASI_Hs01_00158653 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00380595 predicted 2575
2 SASI_Hs02_00380596 predicted 2313
3 SASI_Hs02_00380597 predicted 2328
4 SASI_Hs02_00380598 predicted 2426
5 SASI_Hs02_00380599 predicted 666
6 SASI_Hs02_00380600 predicted 2009
7 SASI_Hs02_00380601 predicted 2243
8 SASI_Hs02_00380602 predicted 2654
9 SASI_Hs02_00380603 predicted 1190
10 SASI_Hs02_00380604 predicted 1822
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018300
VALIDATED
ZNF83 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 83
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018300.3-745s21c1
Sequence:CCGGATACTAAAGAGACGCAATTTACTCGAGTAAATTGCGTCTCTTTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018300.3-1201s21c1
Sequence:CCGGGAAAGGTCTTCCATCATATTTCTCGAGAAATATGATGGAAGACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018300.3-1031s21c1
Sequence:GTACCGGTGGAAAGGTCTTCCATCAAATCTCGAGATTTGATGGAAGACCTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018300.3-1959s21c1
Sequence:CCGGAGAGTGTTCAGTTAGCATTAACTCGAGTTAATGCTAACTGAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018300.3-1299s21c1
Sequence:CCGGCACAAGTCATCCCTAGTAAATCTCGAGATTTACTAGGGATGACTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_018300.2-1355s1c1
Sequence:CCGGCCTAGTAAATCACTGGAGAATCTCGAGATTCTCCAGTGATTTACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018300.2-1512s1c1
Sequence:CCGGCGCAATTCATACCTTGCCCAACTCGAGTTGGGCAAGGTATGAATTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018300.2-1929s1c1
Sequence:CCGGCGCGACAATTCATATCTTGTACTCGAGTACAAGATATGAATTGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018300
VALIDATED
ZNF83 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 83
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018300.3-745s21c1
Sequence:CCGGATACTAAAGAGACGCAATTTACTCGAGTAAATTGCGTCTCTTTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018300.3-1201s21c1
Sequence:CCGGGAAAGGTCTTCCATCATATTTCTCGAGAAATATGATGGAAGACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018300.3-1031s21c1
Sequence:GTACCGGTGGAAAGGTCTTCCATCAAATCTCGAGATTTGATGGAAGACCTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018300.3-1959s21c1
Sequence:CCGGAGAGTGTTCAGTTAGCATTAACTCGAGTTAATGCTAACTGAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018300.3-1299s21c1
Sequence:CCGGCACAAGTCATCCCTAGTAAATCTCGAGATTTACTAGGGATGACTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_018300.2-1355s1c1
Sequence:CCGGCCTAGTAAATCACTGGAGAATCTCGAGATTCTCCAGTGATTTACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018300.2-1512s1c1
Sequence:CCGGCGCAATTCATACCTTGCCCAACTCGAGTTGGGCAAGGTATGAATTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018300.2-1929s1c1
Sequence:CCGGCGCGACAATTCATATCTTGTACTCGAGTACAAGATATGAATTGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018300
VALIDATED
ZNF83 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 83
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018300.3-745s21c1
Sequence:CCGGATACTAAAGAGACGCAATTTACTCGAGTAAATTGCGTCTCTTTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018300.3-1201s21c1
Sequence:CCGGGAAAGGTCTTCCATCATATTTCTCGAGAAATATGATGGAAGACCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018300.3-1031s21c1
Sequence:GTACCGGTGGAAAGGTCTTCCATCAAATCTCGAGATTTGATGGAAGACCTTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018300.3-1959s21c1
Sequence:CCGGAGAGTGTTCAGTTAGCATTAACTCGAGTTAATGCTAACTGAACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018300.3-1299s21c1
Sequence:CCGGCACAAGTCATCCCTAGTAAATCTCGAGATTTACTAGGGATGACTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_018300.2-1355s1c1
Sequence:CCGGCCTAGTAAATCACTGGAGAATCTCGAGATTCTCCAGTGATTTACTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018300.2-1512s1c1
Sequence:CCGGCGCAATTCATACCTTGCCCAACTCGAGTTGGGCAAGGTATGAATTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018300.2-1929s1c1
Sequence:CCGGCGCGACAATTCATATCTTGTACTCGAGTACAAGATATGAATTGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks