EMAIL THIS PAGE TO A FRIEND

ZNF841

zinc finger protein 841

Species: Human ZNF841(284371)
UniProtKB ID: Q6ZN19, B9EG58, Q6ZN82, Q6ZP71, Q8N9U7
Gene ID:
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136499 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136499 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136499 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_209155 Rosetta Predictions human pricing
XM_935357 Rosetta Predictions human pricing
XM_935358 Rosetta Predictions human pricing
XR_015252 Rosetta Predictions human pricing
XR_015660 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_209155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292611 predicted 332
2 SASI_Hs01_00292612 predicted 1768
3 SASI_Hs01_00292613 predicted 511
4 SASI_Hs01_00292614 predicted 1183
5 SASI_Hs01_00292615 predicted 1356
6 SASI_Hs01_00292616 predicted 1864
7 SASI_Hs01_00292617 predicted 2439
8 SASI_Hs01_00292618 predicted 2527
9 SASI_Hs01_00292619 predicted 1427
10 SASI_Hs01_00292620 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00258269 predicted 590
2 SASI_Hs01_00258270 predicted 332
3 SASI_Hs01_00258271 predicted 582
4 SASI_Hs01_00258272 predicted 512
5 SASI_Hs01_00258273 predicted 1176
6 SASI_Hs01_00258274 predicted 1363
7 SASI_Hs01_00258275 predicted 1519
8 SASI_Hs01_00258276 predicted 1607
9 SASI_Hs01_00258277 predicted 449
10 SASI_Hs01_00258278 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262188 predicted 2432
2 SASI_Hs01_00262189 predicted 1930
3 SASI_Hs01_00262190 predicted 747
4 SASI_Hs01_00262191 predicted 684
5 SASI_Hs01_00262192 predicted 1345
6 SASI_Hs01_00262193 predicted 1531
7 SASI_Hs01_00262194 predicted 2033
8 SASI_Hs01_00262195 predicted 2606
9 SASI_Hs01_00262196 predicted 2691
10 SASI_Hs01_00262197 predicted 1593
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_015252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00487554 predicted 862
2 SASI_Hs02_00487555 predicted 2301
3 SASI_Hs02_00487556 predicted 1118
4 SASI_Hs02_00487557 predicted 1718
5 SASI_Hs02_00487558 predicted 1898
6 SASI_Hs02_00487559 predicted 2410
7 SASI_Hs02_00487560 predicted 2976
8 SASI_Hs02_00487561 predicted 3070
9 SASI_Hs02_00487562 predicted 1969
10 SASI_Hs02_00487563 predicted 982
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_015660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00488800 predicted 863
2 SASI_Hs02_00488801 predicted 2305
3 SASI_Hs02_00488802 predicted 1119
4 SASI_Hs02_00488803 predicted 1722
5 SASI_Hs02_00488804 predicted 1894
6 SASI_Hs02_00488805 predicted 2406
7 SASI_Hs02_00488806 predicted 2974
8 SASI_Hs02_00488807 predicted 3066
9 SASI_Hs02_00488808 predicted 1962
10 SASI_Hs02_00488809 predicted 984
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136499
ZNF841 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 841
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136499.1-2184s21c1
Sequence:CCGGGCATGGTCTTCACTTACTATTCTCGAGAATAGTAAGTGAAGACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136499.1-3285s21c1
Sequence:CCGGTCATGTGGAATTGTAGTAATCCTCGAGGATTACTACAATTCCACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136499.1-952s21c1
Sequence:CCGGTGGTCAAAGAGTTCGACATAGCTCGAGCTATGTCGAACTCTTTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136499.1-727s21c1
Sequence:CCGGCACCGGTATCTCTCCTAAATGCTCGAGCATTTAGGAGAGATACCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136499.1-2119s21c1
Sequence:CCGGTGGATACCTTTCGGTTCATATCTCGAGATATGAACCGAAAGGTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136499
ZNF841 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 841
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136499.1-2184s21c1
Sequence:CCGGGCATGGTCTTCACTTACTATTCTCGAGAATAGTAAGTGAAGACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136499.1-3285s21c1
Sequence:CCGGTCATGTGGAATTGTAGTAATCCTCGAGGATTACTACAATTCCACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136499.1-952s21c1
Sequence:CCGGTGGTCAAAGAGTTCGACATAGCTCGAGCTATGTCGAACTCTTTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136499.1-727s21c1
Sequence:CCGGCACCGGTATCTCTCCTAAATGCTCGAGCATTTAGGAGAGATACCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136499.1-2119s21c1
Sequence:CCGGTGGATACCTTTCGGTTCATATCTCGAGATATGAACCGAAAGGTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136499
ZNF841 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 841
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136499.1-2184s21c1
Sequence:CCGGGCATGGTCTTCACTTACTATTCTCGAGAATAGTAAGTGAAGACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136499.1-3285s21c1
Sequence:CCGGTCATGTGGAATTGTAGTAATCCTCGAGGATTACTACAATTCCACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136499.1-952s21c1
Sequence:CCGGTGGTCAAAGAGTTCGACATAGCTCGAGCTATGTCGAACTCTTTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136499.1-727s21c1
Sequence:CCGGCACCGGTATCTCTCCTAAATGCTCGAGCATTTAGGAGAGATACCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136499.1-2119s21c1
Sequence:CCGGTGGATACCTTTCGGTTCATATCTCGAGATATGAACCGAAAGGTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks