EMAIL THIS PAGE TO A FRIEND

ZNF843

zinc finger protein 843

Species: Human ZNF843(283933)
UniProtKB ID: Q8N446, A8K4U8
Gene ID:
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001720820 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001720820 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001720820 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042001 MISSION® esiRNA esiRNA human ZNF843 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001720820 Rosetta Predictions human pricing
XM_290712 Rosetta Predictions human pricing
XM_937979 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001720820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00439097 predicted 1101
2 SASI_Hs02_00439098 predicted 1146
3 SASI_Hs02_00439099 predicted 1139
4 SASI_Hs02_00439100 predicted 1010
5 SASI_Hs02_00439101 predicted 1113
6 SASI_Hs02_00439102 predicted 791
7 SASI_Hs02_00439103 predicted 1400
8 SASI_Hs02_00439104 predicted 1112
9 SASI_Hs02_00439105 predicted 990
10 SASI_Hs02_00439106 predicted 733
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_290712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479013 predicted 1749
2 SASI_Hs02_00479014 predicted 1102
3 SASI_Hs02_00479015 predicted 1952
4 SASI_Hs02_00479016 predicted 1143
5 SASI_Hs02_00479017 predicted 1945
6 SASI_Hs02_00479018 predicted 1008
7 SASI_Hs02_00479019 predicted 1953
8 SASI_Hs02_00479020 predicted 1115
9 SASI_Hs01_00265053 predicted 789
10 SASI_Hs02_00479021 predicted 1746
11 SASI_Hs01_00265051 predicted 362
12 SASI_Hs01_00265052 predicted 435
13 SASI_Hs01_00265054 predicted 440
14 SASI_Hs01_00265055 predicted 515
15 SASI_Hs01_00265056 predicted 361
16 SASI_Hs01_00265057 predicted 502
17 SASI_Hs01_00265058 predicted 433
18 SASI_Hs01_00265059 predicted 486
19 SASI_Hs01_00265060 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_937979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00482804 predicted 1104
2 SASI_Hs02_00482805 predicted 1145
3 SASI_Hs02_00482806 predicted 1139
4 SASI_Hs02_00482807 predicted 1009
5 SASI_Hs02_00482808 predicted 1118
6 SASI_Hs02_00482809 predicted 797
7 SASI_Hs02_00482810 predicted 1399
8 SASI_Hs02_00482811 predicted 1109
9 SASI_Hs02_00482812 predicted 981
10 SASI_Hs02_00482813 predicted 737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001720820
ZNF843 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 843
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720820.1-1175s21c1
Sequence:CCGGTGCGGTGACAGTGTCAATGAGCTCGAGCTCATTGACACTGTCACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720820.1-1706s21c1
Sequence:CCGGAGAGGAGCCCTACCAGTGTTTCTCGAGAAACACTGGTAGGGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720820.1-1376s21c1
Sequence:CCGGCGACCTCCCTTCCTTTATCCTCTCGAGAGGATAAAGGAAGGGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001720820.1-1821s21c1
Sequence:CCGGTGGACTGTGGATCTGAGATGCCTCGAGGCATCTCAGATCCACAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720820.1-1143s21c1
Sequence:CCGGACAGGAGAGTGTGTCCCTTCTCTCGAGAGAAGGGACACACTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001720820
ZNF843 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 843
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720820.1-1175s21c1
Sequence:CCGGTGCGGTGACAGTGTCAATGAGCTCGAGCTCATTGACACTGTCACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720820.1-1706s21c1
Sequence:CCGGAGAGGAGCCCTACCAGTGTTTCTCGAGAAACACTGGTAGGGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720820.1-1376s21c1
Sequence:CCGGCGACCTCCCTTCCTTTATCCTCTCGAGAGGATAAAGGAAGGGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001720820.1-1821s21c1
Sequence:CCGGTGGACTGTGGATCTGAGATGCCTCGAGGCATCTCAGATCCACAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720820.1-1143s21c1
Sequence:CCGGACAGGAGAGTGTGTCCCTTCTCTCGAGAGAAGGGACACACTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001720820
ZNF843 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 843
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720820.1-1175s21c1
Sequence:CCGGTGCGGTGACAGTGTCAATGAGCTCGAGCTCATTGACACTGTCACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720820.1-1706s21c1
Sequence:CCGGAGAGGAGCCCTACCAGTGTTTCTCGAGAAACACTGGTAGGGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720820.1-1376s21c1
Sequence:CCGGCGACCTCCCTTCCTTTATCCTCTCGAGAGGATAAAGGAAGGGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001720820.1-1821s21c1
Sequence:CCGGTGGACTGTGGATCTGAGATGCCTCGAGGCATCTCAGATCCACAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001720820.1-1143s21c1
Sequence:CCGGACAGGAGAGTGTGTCCCTTCTCTCGAGAGAAGGGACACACTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks