EMAIL THIS PAGE TO A FRIEND

ZNF844

zinc finger protein 844

Species: Human ZNF844(284391)
UniProtKB ID: Q08AG5, Q5JPI8
Gene ID:
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136501 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136501 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136501 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_371139 Rosetta Predictions human pricing
XR_015205 Rosetta Predictions human pricing
XR_015644 Rosetta Predictions human pricing
XR_041446 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269300 predicted 1094
2 SASI_Hs01_00269301 predicted 1011
3 SASI_Hs01_00269302 predicted 1085
4 SASI_Hs01_00269303 predicted 478
5 SASI_Hs01_00269304 predicted 573
6 SASI_Hs01_00269305 predicted 292
7 SASI_Hs01_00269306 predicted 386
8 SASI_Hs01_00269307 predicted 370
9 SASI_Hs01_00269308 predicted 1168
10 SASI_Hs01_00269309 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_015205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00487449 predicted 2368
2 SASI_Hs02_00487450 predicted 1765
3 SASI_Hs02_00487451 predicted 528
4 SASI_Hs02_00487452 predicted 2353
5 SASI_Hs02_00487453 predicted 716
6 SASI_Hs02_00487454 predicted 1454
7 SASI_Hs02_00487455 predicted 801
8 SASI_Hs02_00487456 predicted 624
9 SASI_Hs02_00487457 predicted 413
10 SASI_Hs02_00487458 predicted 2595
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_015644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00488730 predicted 2372
2 SASI_Hs02_00488731 predicted 2102
3 SASI_Hs02_00488732 predicted 1771
4 SASI_Hs02_00488733 predicted 532
5 SASI_Hs02_00488734 predicted 2358
6 SASI_Hs02_00488735 predicted 716
7 SASI_Hs02_00488736 predicted 1452
8 SASI_Hs02_00488737 predicted 800
9 SASI_Hs02_00488738 predicted 625
10 SASI_Hs02_00488739 predicted 422
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00527449 predicted 2369
2 SASI_Hs02_00527450 predicted 1769
3 SASI_Hs02_00527451 predicted 529
4 SASI_Hs02_00527452 predicted 2354
5 SASI_Hs02_00527453 predicted 711
6 SASI_Hs02_00527454 predicted 1454
7 SASI_Hs02_00527455 predicted 802
8 SASI_Hs02_00527456 predicted 618
9 SASI_Hs02_00527457 predicted 417
10 SASI_Hs02_00527458 predicted 2600
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136501
ZNF844 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 844
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136501.1-2520s21c1
Sequence:CCGGCTTCCGGTAGCCTTCGATATCCTCGAGGATATCGAAGGCTACCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136501.1-930s21c1
Sequence:CCGGGGTAGTCCCAATTCCCTTTATCTCGAGATAAAGGGAATTGGGACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136501.1-2104s21c1
Sequence:CCGGTGGTTCCTTTCGTAGACATAACTCGAGTTATGTCTACGAAAGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136501.1-760s21c1
Sequence:CCGGGCCCTTGTCTCAGCATATATCCTCGAGGATATATGCTGAGACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136501.1-1217s21c1
Sequence:CCGGCACTAGAATGAGACCTTATAACTCGAGTTATAAGGTCTCATTCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136501
ZNF844 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 844
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136501.1-2520s21c1
Sequence:CCGGCTTCCGGTAGCCTTCGATATCCTCGAGGATATCGAAGGCTACCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136501.1-930s21c1
Sequence:CCGGGGTAGTCCCAATTCCCTTTATCTCGAGATAAAGGGAATTGGGACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136501.1-2104s21c1
Sequence:CCGGTGGTTCCTTTCGTAGACATAACTCGAGTTATGTCTACGAAAGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136501.1-760s21c1
Sequence:CCGGGCCCTTGTCTCAGCATATATCCTCGAGGATATATGCTGAGACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136501.1-1217s21c1
Sequence:CCGGCACTAGAATGAGACCTTATAACTCGAGTTATAAGGTCTCATTCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136501
ZNF844 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 844
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136501.1-2520s21c1
Sequence:CCGGCTTCCGGTAGCCTTCGATATCCTCGAGGATATCGAAGGCTACCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136501.1-930s21c1
Sequence:CCGGGGTAGTCCCAATTCCCTTTATCTCGAGATAAAGGGAATTGGGACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136501.1-2104s21c1
Sequence:CCGGTGGTTCCTTTCGTAGACATAACTCGAGTTATGTCTACGAAAGGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136501.1-760s21c1
Sequence:CCGGGCCCTTGTCTCAGCATATATCCTCGAGGATATATGCTGAGACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136501.1-1217s21c1
Sequence:CCGGCACTAGAATGAGACCTTATAACTCGAGTTATAAGGTCTCATTCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks