EMAIL THIS PAGE TO A FRIEND

ZNF845

zinc finger protein 845

UniProtKB ID: Q96IR2
Gene ID:
cow(100847180) zinc finger protein 845
domestic guinea pig(100731816) zinc finger protein 845
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001725105 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001725105 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001725105 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001725105 Rosetta Predictions human pricing
XM_001725106 Rosetta Predictions human pricing
XM_001725855 Rosetta Predictions human pricing
XM_001725857 Rosetta Predictions human pricing
XM_039908 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00465667 predicted 3102
2 SASI_Hs02_00465668 predicted 3111
3 SASI_Hs02_00465669 predicted 1124
4 SASI_Hs02_00465670 predicted 3103
5 SASI_Hs02_00465671 predicted 1127
6 SASI_Hs02_00465672 predicted 3055
7 SASI_Hs02_00465673 predicted 1129
8 SASI_Hs02_00465674 predicted 2639
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00465675 predicted 3207
2 SASI_Hs02_00465676 predicted 3220
3 SASI_Hs02_00465677 predicted 1220
4 SASI_Hs02_00465678 predicted 3201
5 SASI_Hs02_00465679 predicted 1228
6 SASI_Hs02_00465680 predicted 3151
7 SASI_Hs02_00465681 predicted 1233
8 SASI_Hs02_00465682 predicted 2733
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00470437 predicted 3103
2 SASI_Hs02_00470438 predicted 3119
3 SASI_Hs02_00470439 predicted 1118
4 SASI_Hs02_00470440 predicted 3097
5 SASI_Hs02_00470441 predicted 1125
6 SASI_Hs02_00470442 predicted 3056
7 SASI_Hs02_00470443 predicted 1132
8 SASI_Hs02_00470444 predicted 2632
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00470455 predicted 3205
2 SASI_Hs02_00470456 predicted 3215
3 SASI_Hs02_00470457 predicted 1217
4 SASI_Hs02_00470458 predicted 3203
5 SASI_Hs02_00470459 predicted 1235
6 SASI_Hs02_00470460 predicted 3149
7 SASI_Hs02_00470461 predicted 1231
8 SASI_Hs02_00470462 predicted 2741
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_039908 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261014 predicted 3107
2 SASI_Hs01_00261015 predicted 3119
3 SASI_Hs01_00261016 predicted 1124
4 SASI_Hs01_00261017 predicted 3106
5 SASI_Hs01_00261018 predicted 1125
6 SASI_Hs01_00261019 predicted 3047
7 SASI_Hs01_00261020 predicted 1131
8 SASI_Hs02_00478665 predicted 2633
9 SASI_Hs01_00261013 predicted 560
10 SASI_Hs01_00261021 predicted 1644
11 SASI_Hs01_00261022 predicted 185
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001725105
ZNF845 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 845
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000236601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001725105.1-4067s21c1
Sequence:CCGGATGGGTTGTATGTCTATTTAGCTCGAGCTAAATAGACATACAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001725105.1-4127s21c1
Sequence:CCGGACCTCCTTAATTCAGTTTATTCTCGAGAATAAACTGAATTAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001725105.1-4048s21c1
Sequence:CCGGAGACTTCCAATCCATCAATATCTCGAGATATTGATGGATTGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001725105.1-3993s21c1
Sequence:CCGGTGGGTATCTGTTGAATCTAAACTCGAGTTTAGATTCAACAGATACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001725105
ZNF845 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 845
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000236601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001725105.1-4067s21c1
Sequence:CCGGATGGGTTGTATGTCTATTTAGCTCGAGCTAAATAGACATACAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001725105.1-4127s21c1
Sequence:CCGGACCTCCTTAATTCAGTTTATTCTCGAGAATAAACTGAATTAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001725105.1-4048s21c1
Sequence:CCGGAGACTTCCAATCCATCAATATCTCGAGATATTGATGGATTGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001725105.1-3993s21c1
Sequence:CCGGTGGGTATCTGTTGAATCTAAACTCGAGTTTAGATTCAACAGATACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001725105
ZNF845 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 845
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000236601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001725105.1-4067s21c1
Sequence:CCGGATGGGTTGTATGTCTATTTAGCTCGAGCTAAATAGACATACAACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001725105.1-4127s21c1
Sequence:CCGGACCTCCTTAATTCAGTTTATTCTCGAGAATAAACTGAATTAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236604    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001725105.1-4048s21c1
Sequence:CCGGAGACTTCCAATCCATCAATATCTCGAGATATTGATGGATTGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236603    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001725105.1-3993s21c1
Sequence:CCGGTGGGTATCTGTTGAATCTAAACTCGAGTTTAGATTCAACAGATACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks