EMAIL THIS PAGE TO A FRIEND

ZNF846

zinc finger protein 846

UniProtKB ID: Q147U1, A8K0H1, B3KUP1
Gene ID:
Horse(100059060) zinc finger protein 846
dog(484968) zinc finger protein 846
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA034617 Anti-ZNF846 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001077624 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077624 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077624 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077624 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313024 predicted 758
2 SASI_Hs02_00313025 predicted 643
3 SASI_Hs02_00313026 predicted 1441
4 SASI_Hs02_00313027 predicted 924
5 SASI_Hs02_00313028 predicted 1103
6 SASI_Hs02_00313029 predicted 1410
7 SASI_Hs02_00313030 predicted 1310
8 SASI_Hs02_00313031 predicted 659
9 SASI_Hs02_00313032 predicted 817
10 SASI_Hs02_00313033 predicted 864
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077624
ZNF846 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 846
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077624.1-822s21c1
Sequence:CCGGATCACCAAATGGAGTACAATTCTCGAGAATTGTACTCCATTTGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077624.1-1489s21c1
Sequence:GTACCGGACTAGATCCACAGGACTTATTCTCGAGAATAAGTCCTGTGGATCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077624.1-1238s21c1
Sequence:CCGGGTAATTCCTCACACCTTATAGCTCGAGCTATAAGGTGTGAGGAATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077624.1-1834s21c1
Sequence:CCGGTCGGGCCTTAGTACCCATTTACTCGAGTAAATGGGTACTAAGGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077624.1-1322s21c1
Sequence:CCGGCTCAATCCACAGGACTTAAATCTCGAGATTTAAGTCCTGTGGATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077624
ZNF846 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 846
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077624.1-822s21c1
Sequence:CCGGATCACCAAATGGAGTACAATTCTCGAGAATTGTACTCCATTTGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077624.1-1489s21c1
Sequence:GTACCGGACTAGATCCACAGGACTTATTCTCGAGAATAAGTCCTGTGGATCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077624.1-1238s21c1
Sequence:CCGGGTAATTCCTCACACCTTATAGCTCGAGCTATAAGGTGTGAGGAATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077624.1-1834s21c1
Sequence:CCGGTCGGGCCTTAGTACCCATTTACTCGAGTAAATGGGTACTAAGGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077624.1-1322s21c1
Sequence:CCGGCTCAATCCACAGGACTTAAATCTCGAGATTTAAGTCCTGTGGATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077624
ZNF846 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 846
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077624.1-822s21c1
Sequence:CCGGATCACCAAATGGAGTACAATTCTCGAGAATTGTACTCCATTTGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077624.1-1489s21c1
Sequence:GTACCGGACTAGATCCACAGGACTTATTCTCGAGAATAAGTCCTGTGGATCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077624.1-1238s21c1
Sequence:CCGGGTAATTCCTCACACCTTATAGCTCGAGCTATAAGGTGTGAGGAATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077624.1-1834s21c1
Sequence:CCGGTCGGGCCTTAGTACCCATTTACTCGAGTAAATGGGTACTAAGGCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077624.1-1322s21c1
Sequence:CCGGCTCAATCCACAGGACTTAAATCTCGAGATTTAAGTCCTGTGGATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks