EMAIL THIS PAGE TO A FRIEND

ZNF84

zinc finger protein 84

Synonyms: HPF2
Gene ID:
Horse(100629432) zinc finger protein 84
domestic cat(101095441) zinc finger protein 84
dog(100686099) zinc finger protein 84
domestic guinea pig(101789267) zinc finger protein 84
naked mole-rat(101724401) zinc finger protein 84
Domestic Rabbit(100359340) zinc finger protein 84
cow(512364) zinc finger protein 84
sheep(101110269) zinc finger protein 84
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV35668 Anti-ZNF84 antibody produced in rabbit IgG fraction of antiserum mouse, rat, horse, human, rabbit
immunohistochemistry, western blot pricing
HPA028860 Anti-ZNF84 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003428 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003428 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003428 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119171 MISSION® esiRNA esiRNA human ZNF605 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127372 Rosetta Predictions human pricing
NM_003428 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329284 predicted 365
2 SASI_Hs02_00329285 predicted 863
3 SASI_Hs02_00329286 predicted 1090
4 SASI_Hs02_00329287 predicted 734
5 SASI_Hs02_00329288 predicted 1131
6 SASI_Hs02_00329289 predicted 495
7 SASI_Hs02_00329290 predicted 1568
8 SASI_Hs02_00329291 predicted 2263
9 SASI_Hs02_00329292 predicted 2648
10 SASI_Hs02_00329293 predicted 2587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335640 predicted 942
2 SASI_Hs02_00335641 predicted 1170
3 SASI_Hs01_00096175 predicted 821
4 SASI_Hs01_00096176 predicted 1218
5 SASI_Hs01_00096178 predicted 579
6 SASI_Hs02_00335642 predicted 1657
7 SASI_Hs01_00096180 predicted 2348
8 SASI_Hs01_00096181 predicted 2728
9 SASI_Hs01_00096182 predicted 2671
10 SASI_Hs01_00096183 predicted 1100
11 SASI_Hs01_00096174 predicted 585
12 SASI_Hs01_00096177 predicted 1645
13 SASI_Hs01_00096179 predicted 568
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003428
VALIDATED
ZNF84 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 84
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003428.1-2711s1c1
Sequence:CCGGCCGATCATAATTCATAGAGTACTCGAGTACTCTATGAATTATGATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003428.1-2511s1c1
Sequence:CCGGCTCACAGAAGTCACAGCTCATCTCGAGATGAGCTGTGACTTCTGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_003428.1-1503s1c1
Sequence:CCGGCTTTGAGAAGTCAGAGCTTATCTCGAGATAAGCTCTGACTTCTCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_003428.1-808s1c1
Sequence:CCGGGCAGAATCAGATGACTTTAATCTCGAGATTAAAGTCATCTGATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_003428.1-1757s1c1
Sequence:CCGGGCAGGAAATCACAGCTCGTTACTCGAGTAACGAGCTGTGATTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003428.4-2994s21c1
Sequence:CCGGGCGGGAAATGAGGCAATATTTCTCGAGAAATATTGCCTCATTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003428.4-2693s21c1
Sequence:CCGGACTTCAGGAAATGCAATTATGCTCGAGCATAATTGCATTTCCTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003428.4-714s21c1
Sequence:CCGGGATAACCAAGACAAGCTTAAACTCGAGTTTAAGCTTGTCTTGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003428.4-1677s21c1
Sequence:CCGGGAGAGGTCGAGTCTCATTAATCTCGAGATTAATGAGACTCGACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003428.4-826s21c1
Sequence:CCGGGTGACTTAGATGGATTGATTTCTCGAGAAATCAATCCATCTAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003428.4-3095s21c1
Sequence:CCGGCAACAAGTAACCAGACTATTTCTCGAGAAATAGTCTGGTTACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003428.4-2648s21c1
Sequence:CCGGATCCTAGGAATACAGTTAATACTCGAGTATTAACTGTATTCCTAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003428
VALIDATED
ZNF84 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 84
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003428.1-2711s1c1
Sequence:CCGGCCGATCATAATTCATAGAGTACTCGAGTACTCTATGAATTATGATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003428.1-2511s1c1
Sequence:CCGGCTCACAGAAGTCACAGCTCATCTCGAGATGAGCTGTGACTTCTGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_003428.1-1503s1c1
Sequence:CCGGCTTTGAGAAGTCAGAGCTTATCTCGAGATAAGCTCTGACTTCTCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_003428.1-808s1c1
Sequence:CCGGGCAGAATCAGATGACTTTAATCTCGAGATTAAAGTCATCTGATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_003428.1-1757s1c1
Sequence:CCGGGCAGGAAATCACAGCTCGTTACTCGAGTAACGAGCTGTGATTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003428.4-2994s21c1
Sequence:CCGGGCGGGAAATGAGGCAATATTTCTCGAGAAATATTGCCTCATTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003428.4-2693s21c1
Sequence:CCGGACTTCAGGAAATGCAATTATGCTCGAGCATAATTGCATTTCCTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003428.4-714s21c1
Sequence:CCGGGATAACCAAGACAAGCTTAAACTCGAGTTTAAGCTTGTCTTGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003428.4-1677s21c1
Sequence:CCGGGAGAGGTCGAGTCTCATTAATCTCGAGATTAATGAGACTCGACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003428.4-826s21c1
Sequence:CCGGGTGACTTAGATGGATTGATTTCTCGAGAAATCAATCCATCTAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003428.4-3095s21c1
Sequence:CCGGCAACAAGTAACCAGACTATTTCTCGAGAAATAGTCTGGTTACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003428.4-2648s21c1
Sequence:CCGGATCCTAGGAATACAGTTAATACTCGAGTATTAACTGTATTCCTAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003428
VALIDATED
ZNF84 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 84
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003428.1-2711s1c1
Sequence:CCGGCCGATCATAATTCATAGAGTACTCGAGTACTCTATGAATTATGATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003428.1-2511s1c1
Sequence:CCGGCTCACAGAAGTCACAGCTCATCTCGAGATGAGCTGTGACTTCTGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_003428.1-1503s1c1
Sequence:CCGGCTTTGAGAAGTCAGAGCTTATCTCGAGATAAGCTCTGACTTCTCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_003428.1-808s1c1
Sequence:CCGGGCAGAATCAGATGACTTTAATCTCGAGATTAAAGTCATCTGATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_003428.1-1757s1c1
Sequence:CCGGGCAGGAAATCACAGCTCGTTACTCGAGTAACGAGCTGTGATTTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003428.4-2994s21c1
Sequence:CCGGGCGGGAAATGAGGCAATATTTCTCGAGAAATATTGCCTCATTTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003428.4-2693s21c1
Sequence:CCGGACTTCAGGAAATGCAATTATGCTCGAGCATAATTGCATTTCCTGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003428.4-714s21c1
Sequence:CCGGGATAACCAAGACAAGCTTAAACTCGAGTTTAAGCTTGTCTTGGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003428.4-1677s21c1
Sequence:CCGGGAGAGGTCGAGTCTCATTAATCTCGAGATTAATGAGACTCGACCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003428.4-826s21c1
Sequence:CCGGGTGACTTAGATGGATTGATTTCTCGAGAAATCAATCCATCTAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003428.4-3095s21c1
Sequence:CCGGCAACAAGTAACCAGACTATTTCTCGAGAAATAGTCTGGTTACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003428.4-2648s21c1
Sequence:CCGGATCCTAGGAATACAGTTAATACTCGAGTATTAACTGTATTCCTAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks