EMAIL THIS PAGE TO A FRIEND

ZNF852

zinc finger protein 852

UniProtKB ID: Q6ZMS4
Gene ID:
sheep(101119762) zinc finger protein 852
dog(485566) zinc finger protein 852
domestic cat(101100911) zinc finger protein 852
27 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001717402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001717402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001717402 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128041 MISSION® esiRNA esiRNA human ZNF852 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001717402 Rosetta Predictions human pricing
XM_001717544 Rosetta Predictions human pricing
XM_001725070 Rosetta Predictions human pricing
XM_209579 Rosetta Predictions human pricing
XM_934409 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00417021 predicted 571
2 SASI_Hs02_00417022 predicted 250
3 SASI_Hs02_00417023 predicted 389
4 SASI_Hs02_00417024 predicted 76
5 SASI_Hs02_00417025 predicted 1671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00417872 predicted 485
2 SASI_Hs02_00417873 predicted 302
3 SASI_Hs02_00417874 predicted 170
4 SASI_Hs02_00417875 predicted 1583
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00465413 predicted 488
2 SASI_Hs02_00465414 predicted 300
3 SASI_Hs02_00465415 predicted 171
4 SASI_Hs02_00465416 predicted 1585
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_209579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293099 predicted 485
2 SASI_Hs01_00293100 predicted 1481
3 SASI_Hs01_00293101 predicted 308
4 SASI_Hs01_00293102 predicted 171
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264956 predicted 2670
2 SASI_Hs01_00264957 predicted 3670
3 SASI_Hs01_00264958 predicted 2494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001717402
ZNF852 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 852
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717402.1-264s21c1
Sequence:CCGGGGACCTGTCTGAGGACTATACCTCGAGGTATAGTCCTCAGACAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717402.1-1066s21c1
Sequence:CCGGGCGGCCTTTAGTCGGAGTAAACTCGAGTTTACTCCGACTAAAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717402.1-402s21c1
Sequence:CCGGGCTGACTCCGAAGCAGGAAATCTCGAGATTTCCTGCTTCGGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717402.1-352s21c1
Sequence:CCGGGACCGTAGCATGGCTTCTTTGCTCGAGCAAAGAAGCCATGCTACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717402.1-121s21c1
Sequence:CCGGCACACCACTCTTGGGATAATGCTCGAGCATTATCCCAAGAGTGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001717402
ZNF852 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 852
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717402.1-264s21c1
Sequence:CCGGGGACCTGTCTGAGGACTATACCTCGAGGTATAGTCCTCAGACAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717402.1-1066s21c1
Sequence:CCGGGCGGCCTTTAGTCGGAGTAAACTCGAGTTTACTCCGACTAAAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717402.1-402s21c1
Sequence:CCGGGCTGACTCCGAAGCAGGAAATCTCGAGATTTCCTGCTTCGGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717402.1-352s21c1
Sequence:CCGGGACCGTAGCATGGCTTCTTTGCTCGAGCAAAGAAGCCATGCTACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717402.1-121s21c1
Sequence:CCGGCACACCACTCTTGGGATAATGCTCGAGCATTATCCCAAGAGTGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001717402
ZNF852 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 852
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717402.1-264s21c1
Sequence:CCGGGGACCTGTCTGAGGACTATACCTCGAGGTATAGTCCTCAGACAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717402.1-1066s21c1
Sequence:CCGGGCGGCCTTTAGTCGGAGTAAACTCGAGTTTACTCCGACTAAAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717402.1-402s21c1
Sequence:CCGGGCTGACTCCGAAGCAGGAAATCTCGAGATTTCCTGCTTCGGAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717402.1-352s21c1
Sequence:CCGGGACCGTAGCATGGCTTCTTTGCTCGAGCAAAGAAGCCATGCTACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001717402.1-121s21c1
Sequence:CCGGCACACCACTCTTGGGATAATGCTCGAGCATTATCCCAAGAGTGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks