EMAIL THIS PAGE TO A FRIEND

ZNF853

zinc finger protein 853

UniProtKB ID: P0CG23
Gene ID:
chicken(776211) zinc finger protein 853
cow(789743) zinc finger protein 853
naked mole-rat(101703198) zinc finger protein 853
domestic guinea pig(100719321) zinc finger protein 853
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001715278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001715278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001715278 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715278 Rosetta Predictions human pricing
XM_001716278 Rosetta Predictions human pricing
XM_001716628 Rosetta Predictions human pricing
XM_001723503 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00402606 predicted 5285
2 SASI_Hs02_00402607 predicted 3141
3 SASI_Hs02_00402608 predicted 4604
4 SASI_Hs02_00402609 predicted 2850
5 SASI_Hs02_00402610 predicted 2501
6 SASI_Hs02_00402611 predicted 556
7 SASI_Hs02_00402612 predicted 627
8 SASI_Hs02_00402613 predicted 2501
9 SASI_Hs02_00402614 predicted 4568
10 SASI_Hs02_00402615 predicted 5293
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00409460 predicted 2994
2 SASI_Hs02_00409461 predicted 2128
3 SASI_Hs02_00409462 predicted 2196
4 SASI_Hs02_00409463 predicted 2128
5 SASI_Hs02_00409464 predicted 3043
6 SASI_Hs02_00409465 predicted 2121
7 SASI_Hs02_00409466 predicted 2925
8 SASI_Hs02_00409467 predicted 2287
9 SASI_Hs02_00409468 predicted 3006
10 SASI_Hs02_00409469 predicted 3031
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00411810 predicted 2948
2 SASI_Hs02_00411811 predicted 2071
3 SASI_Hs02_00411812 predicted 2135
4 SASI_Hs02_00411813 predicted 2073
5 SASI_Hs02_00411814 predicted 2985
6 SASI_Hs02_00411815 predicted 579
7 SASI_Hs02_00411816 predicted 2784
8 SASI_Hs02_00411817 predicted 2589
9 SASI_Hs02_00411818 predicted 2726
10 SASI_Hs02_00411819 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00455740 predicted 2387
2 SASI_Hs02_00455741 predicted 1516
3 SASI_Hs02_00455742 predicted 1577
4 SASI_Hs02_00455743 predicted 1510
5 SASI_Hs02_00455744 predicted 2231
6 SASI_Hs02_00455745 predicted 2029
7 SASI_Hs02_00455746 predicted 2024
8 SASI_Hs02_00455747 predicted 2160
9 SASI_Hs02_00455748 predicted 2427
10 SASI_Hs02_00455749 predicted 1512
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001715278
ZNF853 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 853
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000239596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715278.1-565s21c1
Sequence:CCGGTTCTCGCAGCACTCGAATCTGCTCGAGCAGATTCGAGTGCTGCGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715278.1-27s21c1
Sequence:CCGGCTTCGTGCTGGAACTTCAATGCTCGAGCATTGAAGTTCCAGCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715278.1-1082s21c1
Sequence:CCGGAGACGTGCTGCTTCTCCTTTACTCGAGTAAAGGAGAAGCAGCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715278.1-1234s21c1
Sequence:CCGGGAGCTCTGCCCAGTCAATGTTCTCGAGAACATTGACTGGGCAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001715278
ZNF853 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 853
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000239596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715278.1-565s21c1
Sequence:CCGGTTCTCGCAGCACTCGAATCTGCTCGAGCAGATTCGAGTGCTGCGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715278.1-27s21c1
Sequence:CCGGCTTCGTGCTGGAACTTCAATGCTCGAGCATTGAAGTTCCAGCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715278.1-1082s21c1
Sequence:CCGGAGACGTGCTGCTTCTCCTTTACTCGAGTAAAGGAGAAGCAGCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715278.1-1234s21c1
Sequence:CCGGGAGCTCTGCCCAGTCAATGTTCTCGAGAACATTGACTGGGCAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001715278
ZNF853 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 853
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000239596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715278.1-565s21c1
Sequence:CCGGTTCTCGCAGCACTCGAATCTGCTCGAGCAGATTCGAGTGCTGCGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715278.1-27s21c1
Sequence:CCGGCTTCGTGCTGGAACTTCAATGCTCGAGCATTGAAGTTCCAGCACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715278.1-1082s21c1
Sequence:CCGGAGACGTGCTGCTTCTCCTTTACTCGAGTAAAGGAGAAGCAGCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001715278.1-1234s21c1
Sequence:CCGGGAGCTCTGCCCAGTCAATGTTCTCGAGAACATTGACTGGGCAGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks