EMAIL THIS PAGE TO A FRIEND

ZNF85

zinc finger protein 85

Synonyms: HPF4 HTF1
UniProtKB ID: Q03923, B9ZVP4, Q6NVI0
Gene ID:
dog(611599) zinc finger protein 85
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003429 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003429 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237669 predicted 662
2 SASI_Hs01_00237670 predicted 299
3 SASI_Hs01_00237672 predicted 1252
4 SASI_Hs01_00237673 predicted 688
5 SASI_Hs01_00237674 predicted 1933
6 SASI_Hs01_00237675 predicted 679
7 SASI_Hs01_00237671 predicted 683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003429
VALIDATED
ZNF85 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 85
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003429.3-2100s21c1
Sequence:CCGGGTCACACTTTAGGTAAGATAACTCGAGTTATCTTACCTAAAGTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003429.3-617s21c1
Sequence:CCGGCATGAGATAAGACATACTAAACTCGAGTTTAGTATGTCTTATCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003429.1-1983s1c1
Sequence:CCGGCCTGAAAGATGTGACAATAATCTCGAGATTATTGTCACATCTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003429.1-320s1c1
Sequence:CCGGCATGAGATCATGGTGGCCAAACTCGAGTTTGGCCACCATGATCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003429.1-1342s1c1
Sequence:CCGGACACTCTTCAACCCTTACTAACTCGAGTTAGTAAGGGTTGAAGAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003429.1-681s1c1
Sequence:CCGGGCCTAACTGAACATAGCAGAACTCGAGTTCTGCTATGTTCAGTTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003429.1-792s1c1
Sequence:CCGGCGGGAGAGAAACCTTACAAATCTCGAGATTTGTAAGGTTTCTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003429
VALIDATED
ZNF85 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 85
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003429.3-2100s21c1
Sequence:CCGGGTCACACTTTAGGTAAGATAACTCGAGTTATCTTACCTAAAGTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003429.3-617s21c1
Sequence:CCGGCATGAGATAAGACATACTAAACTCGAGTTTAGTATGTCTTATCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003429.1-1983s1c1
Sequence:CCGGCCTGAAAGATGTGACAATAATCTCGAGATTATTGTCACATCTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003429.1-320s1c1
Sequence:CCGGCATGAGATCATGGTGGCCAAACTCGAGTTTGGCCACCATGATCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003429.1-1342s1c1
Sequence:CCGGACACTCTTCAACCCTTACTAACTCGAGTTAGTAAGGGTTGAAGAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003429.1-681s1c1
Sequence:CCGGGCCTAACTGAACATAGCAGAACTCGAGTTCTGCTATGTTCAGTTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003429.1-792s1c1
Sequence:CCGGCGGGAGAGAAACCTTACAAATCTCGAGATTTGTAAGGTTTCTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003429
VALIDATED
ZNF85 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 85
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003429.3-2100s21c1
Sequence:CCGGGTCACACTTTAGGTAAGATAACTCGAGTTATCTTACCTAAAGTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003429.3-617s21c1
Sequence:CCGGCATGAGATAAGACATACTAAACTCGAGTTTAGTATGTCTTATCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003429.1-1983s1c1
Sequence:CCGGCCTGAAAGATGTGACAATAATCTCGAGATTATTGTCACATCTTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003429.1-320s1c1
Sequence:CCGGCATGAGATCATGGTGGCCAAACTCGAGTTTGGCCACCATGATCTCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003429.1-1342s1c1
Sequence:CCGGACACTCTTCAACCCTTACTAACTCGAGTTAGTAAGGGTTGAAGAGTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003429.1-681s1c1
Sequence:CCGGGCCTAACTGAACATAGCAGAACTCGAGTTCTGCTATGTTCAGTTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003429.1-792s1c1
Sequence:CCGGCGGGAGAGAAACCTTACAAATCTCGAGATTTGTAAGGTTTCTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks