EMAIL THIS PAGE TO A FRIEND

ZNF860

zinc finger protein 860

Species: Human ZNF860(344787)
UniProtKB ID: A6NHJ4, B4DFA4
Gene ID:
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001137674 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001137674 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001137674 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001723798 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001723798 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001723798 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001723798 Rosetta Predictions human pricing
XM_001725698 Rosetta Predictions human pricing
XM_496634 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00457653 predicted 700
2 SASI_Hs02_00457654 predicted 501
3 SASI_Hs02_00457655 predicted 505
4 SASI_Hs02_00457656 predicted 323
5 SASI_Hs02_00457657 predicted 511
6 SASI_Hs02_00457658 predicted 325
7 SASI_Hs02_00457659 predicted 214
8 SASI_Hs02_00457660 predicted 128
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00469418 predicted 700
2 SASI_Hs02_00469419 predicted 504
3 SASI_Hs02_00469420 predicted 501
4 SASI_Hs02_00469421 predicted 324
5 SASI_Hs02_00469422 predicted 519
6 SASI_Hs02_00469423 predicted 323
7 SASI_Hs02_00469424 predicted 214
8 SASI_Hs02_00469425 predicted 125
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276458 predicted 702
2 SASI_Hs01_00276459 predicted 502
3 SASI_Hs02_00480036 predicted 1011
4 SASI_Hs01_00276463 predicted 321
5 SASI_Hs01_00276460 predicted 322
6 SASI_Hs01_00276461 predicted 213
7 SASI_Hs02_00480037 predicted 1026
8 SASI_Hs01_00276462 predicted 128
9 SASI_Hs01_00276457 predicted 1019
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001137674
ZNF860 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 860
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000371097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137674.1-726s21c1
Sequence:CCGGCCTGCATTCTGTGGATATCTCCTCGAGGAGATATCCACAGAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137674.1-925s21c1
Sequence:CCGGGCAACTATGACACAAATCAAACTCGAGTTTGATTTGTGTCATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137674.1-1101s21c1
Sequence:CCGGCGATGCTTCCTCAGTTCTAACCTCGAGGTTAGAACTGAGGAAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137674.1-983s21c1
Sequence:CCGGATCCTGGAAACAAGCCTATCACTCGAGTGATAGGCTTGTTTCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001137674
ZNF860 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 860
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000371097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137674.1-726s21c1
Sequence:CCGGCCTGCATTCTGTGGATATCTCCTCGAGGAGATATCCACAGAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137674.1-925s21c1
Sequence:CCGGGCAACTATGACACAAATCAAACTCGAGTTTGATTTGTGTCATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137674.1-1101s21c1
Sequence:CCGGCGATGCTTCCTCAGTTCTAACCTCGAGGTTAGAACTGAGGAAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137674.1-983s21c1
Sequence:CCGGATCCTGGAAACAAGCCTATCACTCGAGTGATAGGCTTGTTTCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001137674
ZNF860 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 860
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000371097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137674.1-726s21c1
Sequence:CCGGCCTGCATTCTGTGGATATCTCCTCGAGGAGATATCCACAGAATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137674.1-925s21c1
Sequence:CCGGGCAACTATGACACAAATCAAACTCGAGTTTGATTTGTGTCATAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137674.1-1101s21c1
Sequence:CCGGCGATGCTTCCTCAGTTCTAACCTCGAGGTTAGAACTGAGGAAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137674.1-983s21c1
Sequence:CCGGATCCTGGAAACAAGCCTATCACTCGAGTGATAGGCTTGTTTCCAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001723798
ZNF860 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 860
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723798.1-360s21c1
Sequence:CCGGACTGGTAGCACCGACAGATATCTCGAGATATCTGTCGGTGCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723798.1-204s21c1
Sequence:CCGGGAAGTGGACACAGGGACATTACTCGAGTAATGTCCCTGTGTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723798.1-1271s21c1
Sequence:CCGGTTCATATCTCGTAGTTCATTGCTCGAGCAATGAACTACGAGATATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001723798.1-2266s21c1
Sequence:CCGGTATGGGTCATATCTCTATTTACTCGAGTAAATAGAGATATGACCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723798.1-509s21c1
Sequence:CCGGCGATGCTTCCTCGGTTCTAACCTCGAGGTTAGAACCGAGGAAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001723798
ZNF860 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 860
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723798.1-360s21c1
Sequence:CCGGACTGGTAGCACCGACAGATATCTCGAGATATCTGTCGGTGCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723798.1-204s21c1
Sequence:CCGGGAAGTGGACACAGGGACATTACTCGAGTAATGTCCCTGTGTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723798.1-1271s21c1
Sequence:CCGGTTCATATCTCGTAGTTCATTGCTCGAGCAATGAACTACGAGATATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001723798.1-2266s21c1
Sequence:CCGGTATGGGTCATATCTCTATTTACTCGAGTAAATAGAGATATGACCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723798.1-509s21c1
Sequence:CCGGCGATGCTTCCTCGGTTCTAACCTCGAGGTTAGAACCGAGGAAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001723798
ZNF860 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 860
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723798.1-360s21c1
Sequence:CCGGACTGGTAGCACCGACAGATATCTCGAGATATCTGTCGGTGCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723798.1-204s21c1
Sequence:CCGGGAAGTGGACACAGGGACATTACTCGAGTAATGTCCCTGTGTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723798.1-1271s21c1
Sequence:CCGGTTCATATCTCGTAGTTCATTGCTCGAGCAATGAACTACGAGATATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001723798.1-2266s21c1
Sequence:CCGGTATGGGTCATATCTCTATTTACTCGAGTAAATAGAGATATGACCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001723798.1-509s21c1
Sequence:CCGGCGATGCTTCCTCGGTTCTAACCTCGAGGTTAGAACCGAGGAAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks