EMAIL THIS PAGE TO A FRIEND

ZNF862

zinc finger protein 862

UniProtKB ID: O60290, A0AUL8
Gene ID:
Horse(100062903) zinc finger protein 862
dog(610840) zinc finger protein 862
domestic cat(101090930) zinc finger protein 862
domestic guinea pig(100731195) zinc finger protein 862
naked mole-rat(101725221) zinc finger protein 862
Domestic Rabbit(100346582) zinc finger protein 862
cow(100139854) zinc finger protein 862
sheep(101121768) zinc finger protein 862
189 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099220 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099220 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099220 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_376720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376720 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126111 MISSION® esiRNA esiRNA human ZNF862 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099220 Rosetta Predictions human pricing
XM_376720 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320219 predicted 705
2 SASI_Hs02_00320220 predicted 740
3 SASI_Hs02_00320221 predicted 721
4 SASI_Hs02_00320222 predicted 2865
5 SASI_Hs02_00320223 predicted 618
6 SASI_Hs02_00320224 predicted 1205
7 SASI_Hs02_00320225 predicted 3325
8 SASI_Hs02_00320226 predicted 329
9 SASI_Hs02_00320227 predicted 1033
10 SASI_Hs02_00320228 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282474 predicted 756
2 SASI_Hs01_00282475 predicted 792
3 SASI_Hs01_00282476 predicted 773
4 SASI_Hs01_00282477 predicted 2916
5 SASI_Hs01_00282478 predicted 676
6 SASI_Hs01_00282479 predicted 1257
7 SASI_Hs01_00282480 predicted 376
8 SASI_Hs01_00282481 predicted 1080
9 SASI_Hs01_00282482 predicted 810
10 SASI_Hs01_00282483 predicted 1074
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099220
VALIDATED
ZNF862 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 862
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099220.1-3100s21c1
Sequence:CCGGCTCAACCTGGCCAGGTATTTCCTCGAGGAAATACCTGGCCAGGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099220.1-4957s21c1
Sequence:CCGGCGATCTTCCTTCCACCTAAAGCTCGAGCTTTAGGTGGAAGGAAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099220.1-706s21c1
Sequence:CCGGGACAAACGGTCAAGACTAATACTCGAGTATTAGTCTTGACCGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099220.1-1605s21c1
Sequence:CCGGGCAGTTCCCATGGTTAGTAATCTCGAGATTACTAACCATGGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099220.1-1670s21c1
Sequence:CCGGGACCTAATCTCCATGATAAATCTCGAGATTTATCATGGAGATTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099220
VALIDATED
ZNF862 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 862
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099220.1-3100s21c1
Sequence:CCGGCTCAACCTGGCCAGGTATTTCCTCGAGGAAATACCTGGCCAGGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099220.1-4957s21c1
Sequence:CCGGCGATCTTCCTTCCACCTAAAGCTCGAGCTTTAGGTGGAAGGAAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099220.1-706s21c1
Sequence:CCGGGACAAACGGTCAAGACTAATACTCGAGTATTAGTCTTGACCGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099220.1-1605s21c1
Sequence:CCGGGCAGTTCCCATGGTTAGTAATCTCGAGATTACTAACCATGGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099220.1-1670s21c1
Sequence:CCGGGACCTAATCTCCATGATAAATCTCGAGATTTATCATGGAGATTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099220
VALIDATED
ZNF862 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 862
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099220.1-3100s21c1
Sequence:CCGGCTCAACCTGGCCAGGTATTTCCTCGAGGAAATACCTGGCCAGGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001099220.1-4957s21c1
Sequence:CCGGCGATCTTCCTTCCACCTAAAGCTCGAGCTTTAGGTGGAAGGAAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099220.1-706s21c1
Sequence:CCGGGACAAACGGTCAAGACTAATACTCGAGTATTAGTCTTGACCGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099220.1-1605s21c1
Sequence:CCGGGCAGTTCCCATGGTTAGTAATCTCGAGATTACTAACCATGGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099220.1-1670s21c1
Sequence:CCGGGACCTAATCTCCATGATAAATCTCGAGATTTATCATGGAGATTAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376720
ZNF862 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 862
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376720.1-805s1c1
Sequence:CCGGGCCCACATGTTCTGTGTCAATCTCGAGATTGACACAGAACATGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376720.1-3042s1c1
Sequence:CCGGGCTGAAGAACATGGAGGTGTTCTCGAGAACACCTCCATGTTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376720.1-1055s1c1
Sequence:CCGGGCATTTCAGATTTGAGGCAAACTCGAGTTTGCCTCAAATCTGAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376720.1-2712s1c1
Sequence:CCGGCGGCTTCCACTTTGTCAAGTTCTCGAGAACTTGACAAAGTGGAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376720.1-1701s1c1
Sequence:CCGGCCATGATAAATCATCTCGGTTCTCGAGAACCGAGATGATTTATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376720
ZNF862 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 862
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376720.1-805s1c1
Sequence:CCGGGCCCACATGTTCTGTGTCAATCTCGAGATTGACACAGAACATGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376720.1-3042s1c1
Sequence:CCGGGCTGAAGAACATGGAGGTGTTCTCGAGAACACCTCCATGTTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376720.1-1055s1c1
Sequence:CCGGGCATTTCAGATTTGAGGCAAACTCGAGTTTGCCTCAAATCTGAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376720.1-2712s1c1
Sequence:CCGGCGGCTTCCACTTTGTCAAGTTCTCGAGAACTTGACAAAGTGGAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376720.1-1701s1c1
Sequence:CCGGCCATGATAAATCATCTCGGTTCTCGAGAACCGAGATGATTTATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376720
ZNF862 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 862
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376720.1-805s1c1
Sequence:CCGGGCCCACATGTTCTGTGTCAATCTCGAGATTGACACAGAACATGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376720.1-3042s1c1
Sequence:CCGGGCTGAAGAACATGGAGGTGTTCTCGAGAACACCTCCATGTTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376720.1-1055s1c1
Sequence:CCGGGCATTTCAGATTTGAGGCAAACTCGAGTTTGCCTCAAATCTGAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376720.1-2712s1c1
Sequence:CCGGCGGCTTCCACTTTGTCAAGTTCTCGAGAACTTGACAAAGTGGAAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376720.1-1701s1c1
Sequence:CCGGCCATGATAAATCATCTCGGTTCTCGAGAACCGAGATGATTTATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks