EMAIL THIS PAGE TO A FRIEND

ZNF878

zinc finger protein 878

Species: Human ZNF878(729747)
UniProtKB ID: C9JN71
Gene ID:
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080404 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080404 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314518 predicted 470
2 SASI_Hs02_00314519 predicted 274
3 SASI_Hs02_00314520 predicted 1185
4 SASI_Hs02_00314521 predicted 1094
5 SASI_Hs02_00314522 predicted 1083
6 SASI_Hs02_00314523 predicted 1078
7 SASI_Hs02_00314524 predicted 988
8 SASI_Hs02_00314525 predicted 400
9 SASI_Hs02_00314526 predicted 753
10 SASI_Hs02_00314527 predicted 1017
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080404
ZNF878 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 878
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080404.1-323s21c1
Sequence:CCGGGAAACCTAAGAAGACTTATAGCTCGAGCTATAAGTCTTCTTAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080404.1-1189s21c1
Sequence:CCGGTTTGTCAAGGATCTTCGAATACTCGAGTATTCGAAGATCCTTGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080404.1-113s21c1
Sequence:CCGGAGTTTGGCCGAAGGCAAATATCTCGAGATATTTGCCTTCGGCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080404.1-427s21c1
Sequence:CCGGACTCCTGGAGTACAATCATATCTCGAGATATGATTGTACTCCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080404.1-477s21c1
Sequence:CCGGAGGTCTTTCATCCCTTAATAGCTCGAGCTATTAAGGGATGAAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080404
ZNF878 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 878
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080404.1-323s21c1
Sequence:CCGGGAAACCTAAGAAGACTTATAGCTCGAGCTATAAGTCTTCTTAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080404.1-1189s21c1
Sequence:CCGGTTTGTCAAGGATCTTCGAATACTCGAGTATTCGAAGATCCTTGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080404.1-113s21c1
Sequence:CCGGAGTTTGGCCGAAGGCAAATATCTCGAGATATTTGCCTTCGGCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080404.1-427s21c1
Sequence:CCGGACTCCTGGAGTACAATCATATCTCGAGATATGATTGTACTCCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080404.1-477s21c1
Sequence:CCGGAGGTCTTTCATCCCTTAATAGCTCGAGCTATTAAGGGATGAAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080404
ZNF878 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 878
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080404.1-323s21c1
Sequence:CCGGGAAACCTAAGAAGACTTATAGCTCGAGCTATAAGTCTTCTTAGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080404.1-1189s21c1
Sequence:CCGGTTTGTCAAGGATCTTCGAATACTCGAGTATTCGAAGATCCTTGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080404.1-113s21c1
Sequence:CCGGAGTTTGGCCGAAGGCAAATATCTCGAGATATTTGCCTTCGGCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080404.1-427s21c1
Sequence:CCGGACTCCTGGAGTACAATCATATCTCGAGATATGATTGTACTCCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080404.1-477s21c1
Sequence:CCGGAGGTCTTTCATCCCTTAATAGCTCGAGCTATTAAGGGATGAAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks