EMAIL THIS PAGE TO A FRIEND

ZNF879

zinc finger protein 879

Synonyms: DKFZp686E2433
UniProtKB ID: B4DU55
Gene ID:
Horse(100067674) zinc finger protein 879
dog(474650) zinc finger protein 879
domestic cat(101086871) zinc finger protein 879
domestic guinea pig(100722114) zinc finger protein 879
naked mole-rat(101728700) zinc finger protein 879
cow(100848207) zinc finger protein 879
sheep(101102724) zinc finger protein 879
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136116 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136116 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136116 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714318 Rosetta Predictions human pricing
XM_001715681 Rosetta Predictions human pricing
XM_001717115 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00396325 predicted 1972
2 SASI_Hs02_00396326 predicted 716
3 SASI_Hs02_00396327 predicted 1272
4 SASI_Hs02_00396328 predicted 1512
5 SASI_Hs02_00396329 predicted 785
6 SASI_Hs02_00396330 predicted 1910
7 SASI_Hs02_00396331 predicted 755
8 SASI_Hs02_00396332 predicted 530
9 SASI_Hs02_00396333 predicted 1339
10 SASI_Hs02_00396334 predicted 1974
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00405360 predicted 1035
2 SASI_Hs02_00405361 predicted 2011
3 SASI_Hs02_00405362 predicted 1998
4 SASI_Hs02_00405363 predicted 757
5 SASI_Hs02_00405364 predicted 1307
6 SASI_Hs02_00405365 predicted 1543
7 SASI_Hs02_00405366 predicted 823
8 SASI_Hs02_00405367 predicted 1937
9 SASI_Hs02_00405368 predicted 787
10 SASI_Hs02_00405369 predicted 1378
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00415078 predicted 2012
2 SASI_Hs02_00415079 predicted 749
3 SASI_Hs02_00415080 predicted 1302
4 SASI_Hs02_00415081 predicted 1551
5 SASI_Hs02_00415082 predicted 819
6 SASI_Hs02_00415083 predicted 1945
7 SASI_Hs02_00415084 predicted 795
8 SASI_Hs02_00415085 predicted 561
9 SASI_Hs02_00415086 predicted 1371
10 SASI_Hs02_00415087 predicted 2004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136116
ZNF879 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 879
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136116.1-1478s21c1
Sequence:CCGGCTTGGATTTCACGGCTTAATACTCGAGTATTAAGCCGTGAAATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136116.1-1562s21c1
Sequence:CCGGGTTCCCACTCAGGCGTTAATACTCGAGTATTAACGCCTGAGTGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136116.1-2095s21c1
Sequence:CCGGAGATTGCAGGGTTAGTATTTGCTCGAGCAAATACTAACCCTGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136116.1-752s21c1
Sequence:CCGGGGGTCAACACAGTGCGTAAATCTCGAGATTTACGCACTGTGTTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136116.1-512s21c1
Sequence:CCGGAGTTGGAGAAGACCTACATAACTCGAGTTATGTAGGTCTTCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136116
ZNF879 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 879
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136116.1-1478s21c1
Sequence:CCGGCTTGGATTTCACGGCTTAATACTCGAGTATTAAGCCGTGAAATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136116.1-1562s21c1
Sequence:CCGGGTTCCCACTCAGGCGTTAATACTCGAGTATTAACGCCTGAGTGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136116.1-2095s21c1
Sequence:CCGGAGATTGCAGGGTTAGTATTTGCTCGAGCAAATACTAACCCTGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136116.1-752s21c1
Sequence:CCGGGGGTCAACACAGTGCGTAAATCTCGAGATTTACGCACTGTGTTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136116.1-512s21c1
Sequence:CCGGAGTTGGAGAAGACCTACATAACTCGAGTTATGTAGGTCTTCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136116
ZNF879 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 879
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136116.1-1478s21c1
Sequence:CCGGCTTGGATTTCACGGCTTAATACTCGAGTATTAAGCCGTGAAATCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136116.1-1562s21c1
Sequence:CCGGGTTCCCACTCAGGCGTTAATACTCGAGTATTAACGCCTGAGTGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136116.1-2095s21c1
Sequence:CCGGAGATTGCAGGGTTAGTATTTGCTCGAGCAAATACTAACCCTGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136116.1-752s21c1
Sequence:CCGGGGGTCAACACAGTGCGTAAATCTCGAGATTTACGCACTGTGTTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136116.1-512s21c1
Sequence:CCGGAGTTGGAGAAGACCTACATAACTCGAGTTATGTAGGTCTTCTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks