EMAIL THIS PAGE TO A FRIEND

ZNF880

zinc finger protein 880

Species: Human ZNF880(400713)
UniProtKB ID: Q6PDB4, B4DNA6
Gene ID:
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145434 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145434 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145434 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_039381 Rosetta Predictions human pricing
XR_039390 Rosetta Predictions human pricing
XR_039621 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00510763 predicted 1535
2 SASI_Hs02_00510764 predicted 315
3 SASI_Hs02_00510765 predicted 1947
4 SASI_Hs02_00510766 predicted 2128
5 SASI_Hs02_00510767 predicted 703
6 SASI_Hs02_00510768 predicted 1867
7 SASI_Hs02_00510769 predicted 2181
8 SASI_Hs02_00510770 predicted 1951
9 SASI_Hs02_00510771 predicted 2178
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00510803 predicted 1373
2 SASI_Hs02_00510804 predicted 314
3 SASI_Hs02_00510805 predicted 1778
4 SASI_Hs02_00510806 predicted 1953
5 SASI_Hs02_00510807 predicted 701
6 SASI_Hs02_00510808 predicted 1699
7 SASI_Hs02_00510809 predicted 2008
8 SASI_Hs02_00510810 predicted 1781
9 SASI_Hs02_00510811 predicted 2008
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00512167 predicted 1539
2 SASI_Hs02_00512168 predicted 320
3 SASI_Hs02_00512169 predicted 1951
4 SASI_Hs02_00512170 predicted 2127
5 SASI_Hs02_00512171 predicted 703
6 SASI_Hs02_00512172 predicted 1868
7 SASI_Hs02_00512173 predicted 2187
8 SASI_Hs02_00512174 predicted 442
9 SASI_Hs02_00512175 predicted 2178
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145434
ZNF880 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 880
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145434.1-1710s21c1
Sequence:CCGGGTAAGGACTTCACTCGAAATTCTCGAGAATTTCGAGTGAAGTCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145434.1-1316s21c1
Sequence:CCGGCTTACTGCCCATCTACTAATTCTCGAGAATTAGTAGATGGGCAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145434.1-2076s21c1
Sequence:CCGGAGATTTACACAAGCGATAATTCTCGAGAATTATCGCTTGTGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145434.1-636s21c1
Sequence:CCGGCTTCAAGACTTGCTAACAATCCTCGAGGATTGTTAGCAAGTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145434.1-1630s21c1
Sequence:CCGGGGTCTTCAGCCACAAGTTATACTCGAGTATAACTTGTGGCTGAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145434
ZNF880 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 880
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145434.1-1710s21c1
Sequence:CCGGGTAAGGACTTCACTCGAAATTCTCGAGAATTTCGAGTGAAGTCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145434.1-1316s21c1
Sequence:CCGGCTTACTGCCCATCTACTAATTCTCGAGAATTAGTAGATGGGCAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145434.1-2076s21c1
Sequence:CCGGAGATTTACACAAGCGATAATTCTCGAGAATTATCGCTTGTGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145434.1-636s21c1
Sequence:CCGGCTTCAAGACTTGCTAACAATCCTCGAGGATTGTTAGCAAGTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145434.1-1630s21c1
Sequence:CCGGGGTCTTCAGCCACAAGTTATACTCGAGTATAACTTGTGGCTGAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145434
ZNF880 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 880
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145434.1-1710s21c1
Sequence:CCGGGTAAGGACTTCACTCGAAATTCTCGAGAATTTCGAGTGAAGTCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145434.1-1316s21c1
Sequence:CCGGCTTACTGCCCATCTACTAATTCTCGAGAATTAGTAGATGGGCAGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145434.1-2076s21c1
Sequence:CCGGAGATTTACACAAGCGATAATTCTCGAGAATTATCGCTTGTGTAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145434.1-636s21c1
Sequence:CCGGCTTCAAGACTTGCTAACAATCCTCGAGGATTGTTAGCAAGTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145434.1-1630s21c1
Sequence:CCGGGGTCTTCAGCCACAAGTTATACTCGAGTATAACTTGTGGCTGAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks