EMAIL THIS PAGE TO A FRIEND

ZNF883

zinc finger protein 883

UniProtKB ID: P0CG24
Gene ID:
cow(100336123) zinc finger protein 883
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001101338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001101338 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101338 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322635 predicted 1780
2 SASI_Hs02_00322636 predicted 1553
3 SASI_Hs02_00322637 predicted 1481
4 SASI_Hs02_00322638 predicted 1575
5 SASI_Hs02_00322639 predicted 2288
6 SASI_Hs02_00322640 predicted 2274
7 SASI_Hs02_00322641 predicted 1375
8 SASI_Hs02_00322642 predicted 2227
9 SASI_Hs02_00322643 predicted 2326
10 SASI_Hs02_00322644 predicted 1377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101338
ZNF883 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 883
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101338.1-1272s21c1
Sequence:CCGGCCCATATCTCTGTACTGAATGCTCGAGCATTCAGTACAGAGATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101338.1-1977s21c1
Sequence:CCGGCAATCGGAGTGCACATCTTACCTCGAGGTAAGATGTGCACTCCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101338.1-1726s21c1
Sequence:CCGGAGCCGCAGCACACACCTAATTCTCGAGAATTAGGTGTGTGCTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101338.1-2146s21c1
Sequence:CCGGTGCTATAGAACATCACTAATTCTCGAGAATTAGTGATGTTCTATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101338.1-1809s21c1
Sequence:GTACCGGTTGCCACAGTACATCACTAATCTCGAGATTAGTGATGTACTGTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101338
ZNF883 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 883
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101338.1-1272s21c1
Sequence:CCGGCCCATATCTCTGTACTGAATGCTCGAGCATTCAGTACAGAGATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101338.1-1977s21c1
Sequence:CCGGCAATCGGAGTGCACATCTTACCTCGAGGTAAGATGTGCACTCCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101338.1-1726s21c1
Sequence:CCGGAGCCGCAGCACACACCTAATTCTCGAGAATTAGGTGTGTGCTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101338.1-2146s21c1
Sequence:CCGGTGCTATAGAACATCACTAATTCTCGAGAATTAGTGATGTTCTATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101338.1-1809s21c1
Sequence:GTACCGGTTGCCACAGTACATCACTAATCTCGAGATTAGTGATGTACTGTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101338
ZNF883 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 883
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101338.1-1272s21c1
Sequence:CCGGCCCATATCTCTGTACTGAATGCTCGAGCATTCAGTACAGAGATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101338.1-1977s21c1
Sequence:CCGGCAATCGGAGTGCACATCTTACCTCGAGGTAAGATGTGCACTCCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101338.1-1726s21c1
Sequence:CCGGAGCCGCAGCACACACCTAATTCTCGAGAATTAGGTGTGTGCTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101338.1-2146s21c1
Sequence:CCGGTGCTATAGAACATCACTAATTCTCGAGAATTAGTGATGTTCTATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101338.1-1809s21c1
Sequence:GTACCGGTTGCCACAGTACATCACTAATCTCGAGATTAGTGATGTACTGTGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks