EMAIL THIS PAGE TO A FRIEND

ZNF888

zinc finger protein 888

Species: Human ZNF888(388559)
UniProtKB ID: P0CJ79
Gene ID:
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001725033 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_001725033 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_001725033 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001725033 Rosetta Predictions human pricing
XM_001725034 Rosetta Predictions human pricing
XM_001725901 Rosetta Predictions human pricing
XM_001725902 Rosetta Predictions human pricing
XM_496322 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00465159 predicted 1619
2 SASI_Hs02_00465160 predicted 550
3 SASI_Hs02_00465161 predicted 799
4 SASI_Hs02_00465162 predicted 785
5 SASI_Hs02_00465163 predicted 1958
6 SASI_Hs02_00465164 predicted 2030
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00465165 predicted 1431
2 SASI_Hs02_00465166 predicted 602
3 SASI_Hs02_00465167 predicted 1139
4 SASI_Hs02_00465168 predicted 853
5 SASI_Hs02_00465169 predicted 841
6 SASI_Hs02_00465170 predicted 1760
7 SASI_Hs02_00465171 predicted 158
8 SASI_Hs02_00465172 predicted 1846
9 SASI_Hs02_00465173 predicted 164
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00470744 predicted 1621
2 SASI_Hs02_00470745 predicted 544
3 SASI_Hs02_00470746 predicted 800
4 SASI_Hs02_00470747 predicted 792
5 SASI_Hs02_00470748 predicted 1956
6 SASI_Hs02_00470749 predicted 2038
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00470750 predicted 1428
2 SASI_Hs02_00470751 predicted 604
3 SASI_Hs02_00470752 predicted 1141
4 SASI_Hs02_00470753 predicted 856
5 SASI_Hs02_00470754 predicted 840
6 SASI_Hs02_00470755 predicted 1760
7 SASI_Hs02_00470756 predicted 163
8 SASI_Hs02_00470757 predicted 1838
9 SASI_Hs02_00470758 predicted 165
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_496322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480013 predicted 549
2 SASI_Hs01_00266232 predicted 801
3 SASI_Hs01_00266233 predicted 792
4 SASI_Hs01_00266230 predicted 1624
5 SASI_Hs01_00266231 predicted 2035
6 SASI_Hs01_00266234 predicted 1960
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001725033
ZNF888 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 888
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725033.1-792s21c1
Sequence:CCGGAGCATACCTTGCACGTCATTACTCGAGTAATGACGTGCAAGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725033.1-301s21c1
Sequence:CCGGACGGGTAGTACAGACCAATATCTCGAGATATTGGTCTGTACTACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725033.1-2043s21c1
Sequence:CCGGTCGTGCACAGTCAACACTTATCTCGAGATAAGTGTTGACTGTGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725033.1-1129s21c1
Sequence:CCGGTCACACCTGGCACAGCATATTCTCGAGAATATGCTGTGCCAGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725033.1-1948s21c1
Sequence:CCGGGACAAGGCTTTCAAGTGTTACCTCGAGGTAACACTTGAAAGCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001725033
ZNF888 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 888
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725033.1-792s21c1
Sequence:CCGGAGCATACCTTGCACGTCATTACTCGAGTAATGACGTGCAAGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725033.1-301s21c1
Sequence:CCGGACGGGTAGTACAGACCAATATCTCGAGATATTGGTCTGTACTACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725033.1-2043s21c1
Sequence:CCGGTCGTGCACAGTCAACACTTATCTCGAGATAAGTGTTGACTGTGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725033.1-1129s21c1
Sequence:CCGGTCACACCTGGCACAGCATATTCTCGAGAATATGCTGTGCCAGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725033.1-1948s21c1
Sequence:CCGGGACAAGGCTTTCAAGTGTTACCTCGAGGTAACACTTGAAAGCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001725033
ZNF888 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 888
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725033.1-792s21c1
Sequence:CCGGAGCATACCTTGCACGTCATTACTCGAGTAATGACGTGCAAGGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725033.1-301s21c1
Sequence:CCGGACGGGTAGTACAGACCAATATCTCGAGATATTGGTCTGTACTACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725033.1-2043s21c1
Sequence:CCGGTCGTGCACAGTCAACACTTATCTCGAGATAAGTGTTGACTGTGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725033.1-1129s21c1
Sequence:CCGGTCACACCTGGCACAGCATATTCTCGAGAATATGCTGTGCCAGGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001725033.1-1948s21c1
Sequence:CCGGGACAAGGCTTTCAAGTGTTACCTCGAGGTAACACTTGAAAGCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks