EMAIL THIS PAGE TO A FRIEND

ZNF8

zinc finger protein 8

Synonyms: HF.18 Zfp128
UniProtKB ID: P17098, Q6PI99
Gene ID:
dog(100686206) zinc finger protein 8
Horse(100051604) zinc finger protein 8
naked mole-rat(101700893) zinc finger protein 8
domestic guinea pig(100729622) zinc finger protein 8
cow(617174) zinc finger protein 8
27 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021089 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042901 MISSION® esiRNA esiRNA human ZNF8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021089 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130301 predicted 514
2 SASI_Hs01_00130302 predicted 1581
3 SASI_Hs01_00130303 predicted 918
4 SASI_Hs01_00130304 predicted 566
5 SASI_Hs01_00130305 predicted 968
6 SASI_Hs01_00130306 predicted 1106
7 SASI_Hs01_00130307 predicted 765
8 SASI_Hs01_00130308 predicted 853
9 SASI_Hs02_00354575 predicted 688
10 SASI_Hs02_00354576 predicted 368
11 SASI_Hs01_00130309 predicted 677
12 SASI_Hs01_00130310 predicted 1486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021089
VALIDATED
ZNF8 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021089.2-911s21c1
Sequence:CCGGGACTGTGGGAAGTCGTTTAACCTCGAGGTTAAACGACTTCCCACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021089.2-1515s21c1
Sequence:CCGGGAAGCGACAGACCCTTCAAATCTCGAGATTTGAAGGGTCTGTCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021089.2-748s21c1
Sequence:CCGGGATTACAGACTCAGAACATAACTCGAGTTATGTTCTGAGTCTGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021089.2-2034s21c1
Sequence:CCGGGTGCCCTCTTTAGCGACATATCTCGAGATATGTCGCTAAAGAGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021089.2-510s21c1
Sequence:CCGGTCCCGACAGATGCTCCTTATCCTCGAGGATAAGGAGCATCTGTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021089.1-2036s1c1
Sequence:CCGGGCCCTCTTTAGCGACATATTTCTCGAGAAATATGTCGCTAAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_021089.1-1439s1c1
Sequence:CCGGCCAGCTCTCACAAAGCATGAACTCGAGTTCATGCTTTGTGAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_021089.1-884s1c1
Sequence:CCGGGTGCAGGACAAACCCTACAAACTCGAGTTTGTAGGGTTTGTCCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021089.1-691s1c1
Sequence:CCGGCCCAAATCCATTCCCAGAGATCTCGAGATCTCTGGGAATGGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021089.1-758s1c1
Sequence:CCGGTCAGAACATAACTCCAGCTTACTCGAGTAAGCTGGAGTTATGTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021089
VALIDATED
ZNF8 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021089.2-911s21c1
Sequence:CCGGGACTGTGGGAAGTCGTTTAACCTCGAGGTTAAACGACTTCCCACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021089.2-1515s21c1
Sequence:CCGGGAAGCGACAGACCCTTCAAATCTCGAGATTTGAAGGGTCTGTCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021089.2-748s21c1
Sequence:CCGGGATTACAGACTCAGAACATAACTCGAGTTATGTTCTGAGTCTGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021089.2-2034s21c1
Sequence:CCGGGTGCCCTCTTTAGCGACATATCTCGAGATATGTCGCTAAAGAGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021089.2-510s21c1
Sequence:CCGGTCCCGACAGATGCTCCTTATCCTCGAGGATAAGGAGCATCTGTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021089.1-2036s1c1
Sequence:CCGGGCCCTCTTTAGCGACATATTTCTCGAGAAATATGTCGCTAAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_021089.1-1439s1c1
Sequence:CCGGCCAGCTCTCACAAAGCATGAACTCGAGTTCATGCTTTGTGAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_021089.1-884s1c1
Sequence:CCGGGTGCAGGACAAACCCTACAAACTCGAGTTTGTAGGGTTTGTCCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021089.1-691s1c1
Sequence:CCGGCCCAAATCCATTCCCAGAGATCTCGAGATCTCTGGGAATGGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021089.1-758s1c1
Sequence:CCGGTCAGAACATAACTCCAGCTTACTCGAGTAAGCTGGAGTTATGTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021089
VALIDATED
ZNF8 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021089.2-911s21c1
Sequence:CCGGGACTGTGGGAAGTCGTTTAACCTCGAGGTTAAACGACTTCCCACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021089.2-1515s21c1
Sequence:CCGGGAAGCGACAGACCCTTCAAATCTCGAGATTTGAAGGGTCTGTCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021089.2-748s21c1
Sequence:CCGGGATTACAGACTCAGAACATAACTCGAGTTATGTTCTGAGTCTGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236571    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021089.2-2034s21c1
Sequence:CCGGGTGCCCTCTTTAGCGACATATCTCGAGATATGTCGCTAAAGAGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021089.2-510s21c1
Sequence:CCGGTCCCGACAGATGCTCCTTATCCTCGAGGATAAGGAGCATCTGTCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108075    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021089.1-2036s1c1
Sequence:CCGGGCCCTCTTTAGCGACATATTTCTCGAGAAATATGTCGCTAAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_021089.1-1439s1c1
Sequence:CCGGCCAGCTCTCACAAAGCATGAACTCGAGTTCATGCTTTGTGAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_021089.1-884s1c1
Sequence:CCGGGTGCAGGACAAACCCTACAAACTCGAGTTTGTAGGGTTTGTCCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021089.1-691s1c1
Sequence:CCGGCCCAAATCCATTCCCAGAGATCTCGAGATCTCTGGGAATGGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021089.1-758s1c1
Sequence:CCGGTCAGAACATAACTCCAGCTTACTCGAGTAAGCTGGAGTTATGTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks