EMAIL THIS PAGE TO A FRIEND

ZNF90

zinc finger protein 90

Synonyms: HTF9
Species: Human ZNF90(7643)
UniProtKB ID: Q03938, B9EH87
Gene ID:
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_371150 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371150 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371150 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159931 MISSION® esiRNA esiRNA human ZNF90 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001714809 Rosetta Predictions human pricing
XM_001718859 Rosetta Predictions human pricing
XM_001719752 Rosetta Predictions human pricing
XM_929675 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00399581 predicted 1861
2 SASI_Hs02_00399582 predicted 1850
3 SASI_Hs02_00399583 predicted 1141
4 SASI_Hs02_00399584 predicted 1732
5 SASI_Hs02_00399585 predicted 1716
6 SASI_Hs02_00399586 predicted 784
7 SASI_Hs02_00399587 predicted 1042
8 SASI_Hs02_00399588 predicted 378
9 SASI_Hs02_00399589 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001718859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00426780 predicted 1859
2 SASI_Hs02_00426781 predicted 1857
3 SASI_Hs02_00426782 predicted 1139
4 SASI_Hs02_00426783 predicted 1733
5 SASI_Hs02_00426784 predicted 1718
6 SASI_Hs02_00426785 predicted 861
7 SASI_Hs02_00426786 predicted 1049
8 SASI_Hs02_00426787 predicted 381
9 SASI_Hs02_00426788 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001719752 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00432363 predicted 1860
2 SASI_Hs02_00432364 predicted 1853
3 SASI_Hs02_00432365 predicted 1143
4 SASI_Hs02_00432366 predicted 1738
5 SASI_Hs02_00432367 predicted 1716
6 SASI_Hs02_00432368 predicted 782
7 SASI_Hs02_00432369 predicted 1042
8 SASI_Hs02_00432370 predicted 382
9 SASI_Hs02_00432371 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276554 predicted 1892
2 SASI_Hs01_00276555 predicted 1178
3 SASI_Hs01_00276556 predicted 1777
4 SASI_Hs01_00276557 predicted 1754
5 SASI_Hs01_00276558 predicted 905
6 SASI_Hs01_00276559 predicted 1089
7 SASI_Hs01_00276560 predicted 422
8 SASI_Hs01_00276561 predicted 1180
9 SASI_Hs01_00276562 predicted 1412
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371150
ZNF90 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 90
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000018183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371150.2-1672s1c1
Sequence:CCGGCGCTCCTCAGTCCTTAGTAAACTCGAGTTTACTAAGGACTGAGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371150.2-1172s1c1
Sequence:CCGGCCTTAGTCCTTCGTACACATACTCGAGTATGTGTACGAAGGACTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371150.2-1004s1c1
Sequence:CCGGCCTCGATCCTTTATGTACATACTCGAGTATGTACATAAAGGATCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371150
ZNF90 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 90
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000018183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371150.2-1672s1c1
Sequence:CCGGCGCTCCTCAGTCCTTAGTAAACTCGAGTTTACTAAGGACTGAGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371150.2-1172s1c1
Sequence:CCGGCCTTAGTCCTTCGTACACATACTCGAGTATGTGTACGAAGGACTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371150.2-1004s1c1
Sequence:CCGGCCTCGATCCTTTATGTACATACTCGAGTATGTACATAAAGGATCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371150
ZNF90 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 90
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000018183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371150.2-1672s1c1
Sequence:CCGGCGCTCCTCAGTCCTTAGTAAACTCGAGTTTACTAAGGACTGAGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371150.2-1172s1c1
Sequence:CCGGCCTTAGTCCTTCGTACACATACTCGAGTATGTGTACGAAGGACTAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371150.2-1004s1c1
Sequence:CCGGCCTCGATCCTTTATGTACATACTCGAGTATGTACATAAAGGATCGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks