EMAIL THIS PAGE TO A FRIEND

ZNF91

zinc finger protein 91

Synonyms: HPF7 HTF10
UniProtKB ID: Q05481, A8K5E1, B7Z6G6
Gene ID:
Human(7644) Summary: The ZNF91 gene encodes a zinc finger protein of the KRAB (Kruppel-associated box) subfamily (Bellefroid et al., 1991, 1993 [PubMed 2023909]
Zebrafish(100151559) zinc finger protein 91
dog(484326) zinc finger protein 91
Horse(100067836) zinc finger protein 91
Horse(100062418) zinc finger protein 91
domestic guinea pig(100733016) zinc finger protein 91
cow(618456) zinc finger protein 91
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102968 Anti-ZNF91 (ab1) antibody produced in rabbit affinity isolated antibody bovine, rat, mouse, human, canine, pig,
western blot pricing
SAB2102969 Anti-ZNF91 (ab2) antibody produced in rabbit affinity isolated antibody human, bovine, rat, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003430 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003430 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232787 predicted 3296
2 SASI_Hs01_00232788 predicted 1690
3 SASI_Hs01_00232791 predicted 352
4 SASI_Hs01_00232792 predicted 1861
5 SASI_Hs01_00232793 predicted 2740
6 SASI_Hs01_00232794 predicted 1018
7 SASI_Hs02_00335643 predicted 1867
8 SASI_Hs02_00335644 predicted 702
9 SASI_Hs02_00335645 predicted 1696
10 SASI_Hs02_00335646 predicted 2026
11 SASI_Hs01_00232789 predicted 1361
12 SASI_Hs01_00232790 predicted 1350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003430
VALIDATED
ZNF91 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 91
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003430.1-3675s1c1
Sequence:CCGGTACAAAAAACTAGCCGGGCGTCTCGAGACGCCCGGCTAGTTTTTTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003430.1-2014s1c1
Sequence:CCGGCCATTCTTCAGCCCTTGCTAACTCGAGTTAGCAAGGGCTGAAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003430.1-2841s1c1
Sequence:CCGGGCAAAGCATTTAGCCAGCCTTCTCGAGAAGGCTGGCTAAATGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_003430.1-687s1c1
Sequence:CCGGCCCAACATAAATGCGTTTATACTCGAGTATAAACGCATTTATGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-1695s21c1
Sequence:CCGGAGACAATCCTTAACCCTTAATCTCGAGATTAAGGGTTAAGGATTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-718s21c1
Sequence:CCGGGCGTTTATATTACAGAGAAGTCTCGAGACTTCTCTGTAATATAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-1276s21c1
Sequence:CCGGAGCGACTCTCAACCCTTACTACTCGAGTAGTAAGGGTTGAGAGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-287s21c1
Sequence:CCGGGCCAGACCTGATTACTTATCTCTCGAGAGATAAGTAATCAGGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-1110s21c1
Sequence:CCGGCGTTCTTCAACCCTTGCTAAACTCGAGTTTAGCAAGGGTTGAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-1871s21c1
Sequence:CCGGCTCAAGTCTTTCTACACATAACTCGAGTTATGTGTAGAAAGACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-3038s21c1
Sequence:CCGGTAGGAAATCTTCAACTCTTACCTCGAGGTAAGAGTTGAAGATTTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003430
VALIDATED
ZNF91 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 91
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003430.1-3675s1c1
Sequence:CCGGTACAAAAAACTAGCCGGGCGTCTCGAGACGCCCGGCTAGTTTTTTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003430.1-2014s1c1
Sequence:CCGGCCATTCTTCAGCCCTTGCTAACTCGAGTTAGCAAGGGCTGAAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003430.1-2841s1c1
Sequence:CCGGGCAAAGCATTTAGCCAGCCTTCTCGAGAAGGCTGGCTAAATGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_003430.1-687s1c1
Sequence:CCGGCCCAACATAAATGCGTTTATACTCGAGTATAAACGCATTTATGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-1695s21c1
Sequence:CCGGAGACAATCCTTAACCCTTAATCTCGAGATTAAGGGTTAAGGATTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-718s21c1
Sequence:CCGGGCGTTTATATTACAGAGAAGTCTCGAGACTTCTCTGTAATATAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-1276s21c1
Sequence:CCGGAGCGACTCTCAACCCTTACTACTCGAGTAGTAAGGGTTGAGAGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-287s21c1
Sequence:CCGGGCCAGACCTGATTACTTATCTCTCGAGAGATAAGTAATCAGGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-1110s21c1
Sequence:CCGGCGTTCTTCAACCCTTGCTAAACTCGAGTTTAGCAAGGGTTGAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-1871s21c1
Sequence:CCGGCTCAAGTCTTTCTACACATAACTCGAGTTATGTGTAGAAAGACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-3038s21c1
Sequence:CCGGTAGGAAATCTTCAACTCTTACCTCGAGGTAAGAGTTGAAGATTTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003430
VALIDATED
ZNF91 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 91
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003430.1-3675s1c1
Sequence:CCGGTACAAAAAACTAGCCGGGCGTCTCGAGACGCCCGGCTAGTTTTTTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003430.1-2014s1c1
Sequence:CCGGCCATTCTTCAGCCCTTGCTAACTCGAGTTAGCAAGGGCTGAAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003430.1-2841s1c1
Sequence:CCGGGCAAAGCATTTAGCCAGCCTTCTCGAGAAGGCTGGCTAAATGCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_003430.1-687s1c1
Sequence:CCGGCCCAACATAAATGCGTTTATACTCGAGTATAAACGCATTTATGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-1695s21c1
Sequence:CCGGAGACAATCCTTAACCCTTAATCTCGAGATTAAGGGTTAAGGATTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-718s21c1
Sequence:CCGGGCGTTTATATTACAGAGAAGTCTCGAGACTTCTCTGTAATATAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-1276s21c1
Sequence:CCGGAGCGACTCTCAACCCTTACTACTCGAGTAGTAAGGGTTGAGAGTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-287s21c1
Sequence:CCGGGCCAGACCTGATTACTTATCTCTCGAGAGATAAGTAATCAGGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-1110s21c1
Sequence:CCGGCGTTCTTCAACCCTTGCTAAACTCGAGTTTAGCAAGGGTTGAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-1871s21c1
Sequence:CCGGCTCAAGTCTTTCTACACATAACTCGAGTTATGTGTAGAAAGACTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003430.2-3038s21c1
Sequence:CCGGTAGGAAATCTTCAACTCTTACCTCGAGGTAAGAGTTGAAGATTTCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks