EMAIL THIS PAGE TO A FRIEND

ZNF93

zinc finger protein 93

Synonyms: HPF34 HTF34 TF34 ZNF505
UniProtKB ID: P35789, A6NMY2, B9EGT2, Q8N8Q4, Q9H9X5, Q9Y2N8
Gene ID:
cow(506495) zinc finger protein 93
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102970 Anti-ZNF93 antibody produced in rabbit affinity isolated antibody rat, bovine, zebrafish, human, mouse, horse, rabbit
western blot pricing
SAB1305310 ANTI-ZNF93(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031218 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031218 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031218 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004126 Rosetta Predictions human pricing
NM_031218 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079340 predicted 608
2 SASI_Hs01_00079341 predicted 601
3 SASI_Hs01_00079342 predicted 583
4 SASI_Hs01_00079343 predicted 601
5 SASI_Hs01_00079344 predicted 604
6 SASI_Hs01_00079345 predicted 261
7 SASI_Hs01_00079346 predicted 613
8 SASI_Hs01_00079347 predicted 620
9 SASI_Hs01_00079348 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187219 predicted 1405
2 SASI_Hs01_00187221 predicted 1179
3 SASI_Hs01_00187222 predicted 502
4 SASI_Hs01_00187223 predicted 808
5 SASI_Hs01_00187224 predicted 433
6 SASI_Hs01_00187225 predicted 2028
7 SASI_Hs01_00187220 predicted 1746
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031218
ZNF93 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 93
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031218.2-1085s1c1
Sequence:CCGGCCCGTATCCTTACTACACATACTCGAGTATGTGTAGTAAGGATACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031218.2-513s1c1
Sequence:CCGGCCAGTGTAGTACAACTACCCACTCGAGTGGGTAGTTGTACTACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031218.2-1931s1c1
Sequence:CCGGGCCTTAGTAGACATGAGATAACTCGAGTTATCTCATGTCTACTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031218.2-755s1c1
Sequence:CCGGCCCTTAATACACATAAGAGAACTCGAGTTCTCTTATGTGTATTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031218.2-332s1c1
Sequence:CCGGCCTCAGTTATATGTTCTCATTCTCGAGAATGAGAACATATAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031218.3-2439s21c1
Sequence:CCGGGTGAAGTCCTGAAGGATATTTCTCGAGAAATATCCTTCAGGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031218.3-978s21c1
Sequence:CCGGCAATCCTCGACACTTACTAAACTCGAGTTTAGTAAGTGTCGAGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031218.3-2287s21c1
Sequence:CCGGAGGTCAGTTCTGCCTATATAGCTCGAGCTATATAGGCAGAACTGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031218
ZNF93 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 93
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031218.2-1085s1c1
Sequence:CCGGCCCGTATCCTTACTACACATACTCGAGTATGTGTAGTAAGGATACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031218.2-513s1c1
Sequence:CCGGCCAGTGTAGTACAACTACCCACTCGAGTGGGTAGTTGTACTACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031218.2-1931s1c1
Sequence:CCGGGCCTTAGTAGACATGAGATAACTCGAGTTATCTCATGTCTACTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031218.2-755s1c1
Sequence:CCGGCCCTTAATACACATAAGAGAACTCGAGTTCTCTTATGTGTATTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031218.2-332s1c1
Sequence:CCGGCCTCAGTTATATGTTCTCATTCTCGAGAATGAGAACATATAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031218.3-2439s21c1
Sequence:CCGGGTGAAGTCCTGAAGGATATTTCTCGAGAAATATCCTTCAGGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031218.3-978s21c1
Sequence:CCGGCAATCCTCGACACTTACTAAACTCGAGTTTAGTAAGTGTCGAGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031218.3-2287s21c1
Sequence:CCGGAGGTCAGTTCTGCCTATATAGCTCGAGCTATATAGGCAGAACTGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031218
ZNF93 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 93
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031218.2-1085s1c1
Sequence:CCGGCCCGTATCCTTACTACACATACTCGAGTATGTGTAGTAAGGATACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031218.2-513s1c1
Sequence:CCGGCCAGTGTAGTACAACTACCCACTCGAGTGGGTAGTTGTACTACACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031218.2-1931s1c1
Sequence:CCGGGCCTTAGTAGACATGAGATAACTCGAGTTATCTCATGTCTACTAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031218.2-755s1c1
Sequence:CCGGCCCTTAATACACATAAGAGAACTCGAGTTCTCTTATGTGTATTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031218.2-332s1c1
Sequence:CCGGCCTCAGTTATATGTTCTCATTCTCGAGAATGAGAACATATAACTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031218.3-2439s21c1
Sequence:CCGGGTGAAGTCCTGAAGGATATTTCTCGAGAAATATCCTTCAGGACTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031218.3-978s21c1
Sequence:CCGGCAATCCTCGACACTTACTAAACTCGAGTTTAGTAAGTGTCGAGGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031218.3-2287s21c1
Sequence:CCGGAGGTCAGTTCTGCCTATATAGCTCGAGCTATATAGGCAGAACTGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks