EMAIL THIS PAGE TO A FRIEND

ZNF98

zinc finger protein 98

Synonyms: F7175 ZNF739
Species: Human ZNF98(148198)
UniProtKB ID: A6NK75
Gene ID:
18 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306457 ANTI-ZNF98 (C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098626 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098626 Rosetta Predictions human pricing
XM_047554 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319566 predicted 1781
2 SASI_Hs02_00319567 predicted 1447
3 SASI_Hs02_00319568 predicted 1451
4 SASI_Hs02_00319569 predicted 1774
5 SASI_Hs02_00319570 predicted 1785
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_047554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259226 predicted 1201
2 SASI_Hs01_00259227 predicted 1830
3 SASI_Hs01_00259228 predicted 850
4 SASI_Hs01_00259229 predicted 1778
5 SASI_Hs01_00259230 predicted 1453
6 SASI_Hs01_00259231 predicted 1449
7 SASI_Hs01_00259232 predicted 1194
8 SASI_Hs01_00259233 predicted 1187
9 SASI_Hs01_00259234 predicted 1765
10 SASI_Hs01_00259235 predicted 1779
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098626
ZNF98 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 98
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098626.1-877s21c1
Sequence:CCGGACCTTACTACACATAAGATAACTCGAGTTATCTTATGTGTAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098626.1-1129s21c1
Sequence:CCGGCCCTTACTACACATAAGATAACTCGAGTTATCTTATGTGTAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098626.1-1045s21c1
Sequence:CCGGCCCTTACTGCACATAAGATAACTCGAGTTATCTTATGTGCAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098626.1-705s21c1
Sequence:CCGGTCACACTTAGCTCAACATAAACTCGAGTTTATGTTGAGCTAAGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098626.1-1987s21c1
Sequence:CCGGTATACTTGATGAGAACAAATGCTCGAGCATTTGTTCTCATCAAGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098626
ZNF98 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 98
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098626.1-877s21c1
Sequence:CCGGACCTTACTACACATAAGATAACTCGAGTTATCTTATGTGTAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098626.1-1129s21c1
Sequence:CCGGCCCTTACTACACATAAGATAACTCGAGTTATCTTATGTGTAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098626.1-1045s21c1
Sequence:CCGGCCCTTACTGCACATAAGATAACTCGAGTTATCTTATGTGCAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098626.1-705s21c1
Sequence:CCGGTCACACTTAGCTCAACATAAACTCGAGTTTATGTTGAGCTAAGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098626.1-1987s21c1
Sequence:CCGGTATACTTGATGAGAACAAATGCTCGAGCATTTGTTCTCATCAAGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098626
ZNF98 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 98
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098626.1-877s21c1
Sequence:CCGGACCTTACTACACATAAGATAACTCGAGTTATCTTATGTGTAGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098626.1-1129s21c1
Sequence:CCGGCCCTTACTACACATAAGATAACTCGAGTTATCTTATGTGTAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098626.1-1045s21c1
Sequence:CCGGCCCTTACTGCACATAAGATAACTCGAGTTATCTTATGTGCAGTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098626.1-705s21c1
Sequence:CCGGTCACACTTAGCTCAACATAAACTCGAGTTTATGTTGAGCTAAGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236729    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098626.1-1987s21c1
Sequence:CCGGTATACTTGATGAGAACAAATGCTCGAGCATTTGTTCTCATCAAGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks