EMAIL THIS PAGE TO A FRIEND

ZNF99

zinc finger protein 99

Synonyms: C19orf9 F8281
Species: Human ZNF99(7652)
UniProtKB ID: A8MXY4
Gene ID:
11 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302664 ANTI-ZNF99 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080409 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080409 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080409 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080409 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080409 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314568 predicted 2860
2 SASI_Hs02_00314569 predicted 340
3 SASI_Hs02_00314570 predicted 863
4 SASI_Hs02_00314571 predicted 2179
5 SASI_Hs02_00314572 predicted 3052
6 SASI_Hs02_00314573 predicted 3053
7 SASI_Hs02_00314574 predicted 25
8 SASI_Hs02_00314575 predicted 21
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080409
ZNF99 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 99
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080409.1-262s21c1
Sequence:CCGGAGACATGAGATGGTAACTAAACTCGAGTTTAGTTACCATCTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080409.1-2474s21c1
Sequence:CCGGCTAGGGAGAAATCGTACAAATCTCGAGATTTGTACGATTTCTCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080409.1-2123s21c1
Sequence:GTACCGGACAATTCCTCAACCCTTAGAACTCGAGTTCTAAGGGTTGAGGAATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080409.1-2859s21c1
Sequence:CCGGTAGCCATTTCTCACGCCTTACCTCGAGGTAAGGCGTGAGAAATGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080409.1-2077s21c1
Sequence:CCGGACTGGAAAGAAACCCTATAAACTCGAGTTTATAGGGTTTCTTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080409
ZNF99 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 99
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080409.1-262s21c1
Sequence:CCGGAGACATGAGATGGTAACTAAACTCGAGTTTAGTTACCATCTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080409.1-2474s21c1
Sequence:CCGGCTAGGGAGAAATCGTACAAATCTCGAGATTTGTACGATTTCTCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080409.1-2123s21c1
Sequence:GTACCGGACAATTCCTCAACCCTTAGAACTCGAGTTCTAAGGGTTGAGGAATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080409.1-2859s21c1
Sequence:CCGGTAGCCATTTCTCACGCCTTACCTCGAGGTAAGGCGTGAGAAATGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080409.1-2077s21c1
Sequence:CCGGACTGGAAAGAAACCCTATAAACTCGAGTTTATAGGGTTTCTTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080409
ZNF99 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 99
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080409.1-262s21c1
Sequence:CCGGAGACATGAGATGGTAACTAAACTCGAGTTTAGTTACCATCTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080409.1-2474s21c1
Sequence:CCGGCTAGGGAGAAATCGTACAAATCTCGAGATTTGTACGATTTCTCCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080409.1-2123s21c1
Sequence:GTACCGGACAATTCCTCAACCCTTAGAACTCGAGTTCTAAGGGTTGAGGAATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080409.1-2859s21c1
Sequence:CCGGTAGCCATTTCTCACGCCTTACCTCGAGGTAAGGCGTGAGAAATGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080409.1-2077s21c1
Sequence:CCGGACTGGAAAGAAACCCTATAAACTCGAGTTTATAGGGTTTCTTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks