EMAIL THIS PAGE TO A FRIEND

ZNFX1

zinc finger, NFX1-type containing 1

Gene ID:
Mouse(98999) zinc finger, NFX1-type containing 1
Rat(296384) zinc finger, NFX1-type containing 1
Zebrafish(322409) zinc finger, NFX1-type containing 1
chicken(419218) zinc finger, NFX1-type containing 1
dog(477260) zinc finger, NFX1-type containing 1
domestic cat(101080372) zinc finger, NFX1-type containing 1
Horse(100056967) zinc finger, NFX1-type containing 1
cow(539807) zinc finger, NFX1-type containing 1
sheep(101121112) zinc finger, NFX1-type containing 1
domestic guinea pig(100725377) zinc finger, NFX1-type containing 1
naked mole-rat(101703421) zinc finger, NFX1-type containing 1
Domestic Rabbit(100350695) zinc finger, NFX1-type containing 1
200 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021035 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021035 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021035 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033196 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033196 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033196 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021035 Rosetta Predictions human pricing
NM_001047860 Rosetta Predictions rat pricing
NM_001033196 Rosetta Predictions mouse pricing
XM_895133 Rosetta Predictions mouse pricing
XM_902970 Rosetta Predictions mouse pricing
XM_902971 Rosetta Predictions mouse pricing
XM_902972 Rosetta Predictions mouse pricing
XM_902973 Rosetta Predictions mouse pricing
XM_902974 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057423 predicted 5463
2 SASI_Hs01_00057424 predicted 5531
3 SASI_Hs01_00057425 predicted 1339
4 SASI_Hs01_00057426 predicted 4040
5 SASI_Hs01_00057427 predicted 4512
6 SASI_Hs01_00057428 predicted 4851
7 SASI_Hs01_00057429 predicted 4956
8 SASI_Hs02_00354511 predicted 3643
9 SASI_Hs02_00354512 predicted 4600
10 SASI_Hs01_00057431 predicted 4167
11 SASI_Hs01_00057430 predicted 802
12 SASI_Hs01_00057432 predicted 1429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047860 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206275 predicted 1372
2 SASI_Rn02_00206276 predicted 2258
3 SASI_Rn02_00206277 predicted 1556
4 SASI_Rn02_00206278 predicted 1016
5 SASI_Rn02_00206279 predicted 5635
6 SASI_Rn02_00206280 predicted 2304
7 SASI_Rn02_00206281 predicted 1577
8 SASI_Rn02_00206282 predicted 3481
9 SASI_Rn02_00206283 predicted 1982
10 SASI_Rn02_00206284 predicted 2322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033196 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288303 predicted 2442
2 SASI_Mm02_00288304 predicted 1738
3 SASI_Mm02_00288305 predicted 3643
4 SASI_Mm02_00288306 predicted 1751
5 SASI_Mm02_00288307 predicted 4778
6 SASI_Mm02_00288308 predicted 2097
7 SASI_Mm02_00288309 predicted 2263
8 SASI_Mm02_00288310 predicted 5815
9 SASI_Mm02_00288311 predicted 4746
10 SASI_Mm02_00288312 predicted 3862
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895133 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278628 predicted 3200
2 SASI_Mm01_00278629 predicted 2489
3 SASI_Mm01_00278630 predicted 4406
4 SASI_Mm01_00278631 predicted 2506
5 SASI_Mm01_00278632 predicted 5536
6 SASI_Mm01_00278633 predicted 2846
7 SASI_Mm01_00278634 predicted 3019
8 SASI_Mm01_00278635 predicted 6575
9 SASI_Mm01_00278636 predicted 4424
10 SASI_Mm01_00278637 predicted 4617
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902970 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221269 predicted 1414
2 SASI_Mm01_00221270 predicted 1294
3 SASI_Mm01_00221271 predicted 1734
4 SASI_Mm01_00221272 predicted 304
5 SASI_Mm01_00221273 predicted 1425
6 SASI_Mm01_00221274 predicted 1760
7 SASI_Mm01_00221275 predicted 317
8 SASI_Mm01_00221276 predicted 1935
9 SASI_Mm01_00221277 predicted 1106
10 SASI_Mm01_00221278 predicted 1645
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902971 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258178 predicted 2069
2 SASI_Mm01_00258179 predicted 1359
3 SASI_Mm01_00258180 predicted 1253
4 SASI_Mm01_00258181 predicted 1682
5 SASI_Mm01_00258182 predicted 244
6 SASI_Mm01_00258183 predicted 1376
7 SASI_Mm01_00258184 predicted 1710
8 SASI_Mm01_00258185 predicted 267
9 SASI_Mm01_00258186 predicted 2292
10 SASI_Mm01_00258187 predicted 1882
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902972 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208663 predicted 582
2 SASI_Mm01_00208664 predicted 1716
3 SASI_Mm01_00208665 predicted 633
4 SASI_Mm01_00208666 predicted 2753
5 SASI_Mm01_00208667 predicted 2363
6 SASI_Mm01_00208668 predicted 355
7 SASI_Mm01_00208669 predicted 609
8 SASI_Mm01_00208670 predicted 3296
9 SASI_Mm01_00208671 predicted 773
10 SASI_Mm01_00208672 predicted 1685
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00261613 predicted 2060
2 SASI_Mm01_00261614 predicted 1366
3 SASI_Mm01_00261615 predicted 3272
4 SASI_Mm01_00261616 predicted 1374
5 SASI_Mm01_00261617 predicted 4403
6 SASI_Mm01_00261618 predicted 1711
7 SASI_Mm01_00261619 predicted 1879
8 SASI_Mm01_00261620 predicted 5438
9 SASI_Mm01_00261621 predicted 3292
10 SASI_Mm01_00261622 predicted 3484
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284389 predicted 2038
2 SASI_Mm01_00284390 predicted 1333
3 SASI_Mm01_00284391 predicted 3234
4 SASI_Mm01_00284392 predicted 1353
5 SASI_Mm01_00284393 predicted 4375
6 SASI_Mm01_00284394 predicted 1687
7 SASI_Mm01_00284395 predicted 1855
8 SASI_Mm01_00284396 predicted 5406
9 SASI_Mm01_00284397 predicted 3257
10 SASI_Mm01_00284398 predicted 3458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021035
VALIDATED
ZNFX1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, NFX1-type containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_021035.2-740s21c1
Sequence:CCGGGCCACAAGTTTAGGGCTGAAACTCGAGTTTCAGCCCTAAACTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021035.2-5855s21c1
Sequence:CCGGCCTGACTGTAAGGAAGTGATTCTCGAGAATCACTTCCTTACAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_021035.2-1243s21c1
Sequence:CCGGCTACCGAACCATGCCCATTTACTCGAGTAAATGGGCATGGTTCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021035.2-4648s21c1
Sequence:CCGGCCTGCTTATCTGCTCACACAACTCGAGTTGTGTGAGCAGATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274464    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_021035.2-6408s21c1
Sequence:CCGGTTAGTCTTAGCACCTACTTAACTCGAGTTAAGTAGGTGCTAAGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021035.1-578s1c1
Sequence:CCGGGCCACAAGTTTAGGGCTGAAACTCGAGTTTCAGCCCTAAACTTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021035.1-5718s1c1
Sequence:CCGGGCACAAATCATACTCTGGAAACTCGAGTTTCCAGAGTATGATTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_021035.1-4486s1c1
Sequence:CCGGCCTGCTTATCTGCTCACACAACTCGAGTTGTGTGAGCAGATAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_021035.1-5693s1c1
Sequence:CCGGCCTGACTGTAAGGAAGTGATTCTCGAGAATCACTTCCTTACAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021035.1-3018s1c1
Sequence:CCGGCCCAGGTTGTAGGAATGACAACTCGAGTTGTCATTCCTACAACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021035
VALIDATED
ZNFX1 MISSION shRNA shRNA Plasmid DNA
zinc finger, NFX1-type containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_021035.2-740s21c1
Sequence:CCGGGCCACAAGTTTAGGGCTGAAACTCGAGTTTCAGCCCTAAACTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021035.2-5855s21c1
Sequence:CCGGCCTGACTGTAAGGAAGTGATTCTCGAGAATCACTTCCTTACAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_021035.2-1243s21c1
Sequence:CCGGCTACCGAACCATGCCCATTTACTCGAGTAAATGGGCATGGTTCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021035.2-4648s21c1
Sequence:CCGGCCTGCTTATCTGCTCACACAACTCGAGTTGTGTGAGCAGATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274464    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_021035.2-6408s21c1
Sequence:CCGGTTAGTCTTAGCACCTACTTAACTCGAGTTAAGTAGGTGCTAAGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021035.1-578s1c1
Sequence:CCGGGCCACAAGTTTAGGGCTGAAACTCGAGTTTCAGCCCTAAACTTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021035.1-5718s1c1
Sequence:CCGGGCACAAATCATACTCTGGAAACTCGAGTTTCCAGAGTATGATTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_021035.1-4486s1c1
Sequence:CCGGCCTGCTTATCTGCTCACACAACTCGAGTTGTGTGAGCAGATAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_021035.1-5693s1c1
Sequence:CCGGCCTGACTGTAAGGAAGTGATTCTCGAGAATCACTTCCTTACAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021035.1-3018s1c1
Sequence:CCGGCCCAGGTTGTAGGAATGACAACTCGAGTTGTCATTCCTACAACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021035
VALIDATED
ZNFX1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, NFX1-type containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_021035.2-740s21c1
Sequence:CCGGGCCACAAGTTTAGGGCTGAAACTCGAGTTTCAGCCCTAAACTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021035.2-5855s21c1
Sequence:CCGGCCTGACTGTAAGGAAGTGATTCTCGAGAATCACTTCCTTACAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_021035.2-1243s21c1
Sequence:CCGGCTACCGAACCATGCCCATTTACTCGAGTAAATGGGCATGGTTCGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021035.2-4648s21c1
Sequence:CCGGCCTGCTTATCTGCTCACACAACTCGAGTTGTGTGAGCAGATAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274464    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_021035.2-6408s21c1
Sequence:CCGGTTAGTCTTAGCACCTACTTAACTCGAGTTAAGTAGGTGCTAAGACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021035.1-578s1c1
Sequence:CCGGGCCACAAGTTTAGGGCTGAAACTCGAGTTTCAGCCCTAAACTTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021035.1-5718s1c1
Sequence:CCGGGCACAAATCATACTCTGGAAACTCGAGTTTCCAGAGTATGATTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_021035.1-4486s1c1
Sequence:CCGGCCTGCTTATCTGCTCACACAACTCGAGTTGTGTGAGCAGATAAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_021035.1-5693s1c1
Sequence:CCGGCCTGACTGTAAGGAAGTGATTCTCGAGAATCACTTCCTTACAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021035.1-3018s1c1
Sequence:CCGGCCCAGGTTGTAGGAATGACAACTCGAGTTGTCATTCCTACAACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033196
VALIDATED
ZNFX1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, NFX1-type containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033196.2-1600s21c1
Sequence:CCGGCAACATCATTTCCGGGAAATACTCGAGTATTTCCCGGAAATGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033196.2-2407s21c1
Sequence:CCGGCAAGACTTACGTGGGTCTAAACTCGAGTTTAGACCCACGTAAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033196.2-2669s21c1
Sequence:CCGGCGGAGGGCCTATATGAGTATTCTCGAGAATACTCATATAGGCCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033196.2-6771s21c1
Sequence:CCGGTCTCCATGGCCCAGTTATATACTCGAGTATATAACTGGGCCATGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033196.2-2991s21c1
Sequence:CCGGAGGGTTCCCTAATCGAGATTGCTCGAGCAATCTCGATTAGGGAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033196
VALIDATED
ZNFX1 MISSION shRNA shRNA Plasmid DNA
zinc finger, NFX1-type containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033196.2-1600s21c1
Sequence:CCGGCAACATCATTTCCGGGAAATACTCGAGTATTTCCCGGAAATGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033196.2-2407s21c1
Sequence:CCGGCAAGACTTACGTGGGTCTAAACTCGAGTTTAGACCCACGTAAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033196.2-2669s21c1
Sequence:CCGGCGGAGGGCCTATATGAGTATTCTCGAGAATACTCATATAGGCCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033196.2-6771s21c1
Sequence:CCGGTCTCCATGGCCCAGTTATATACTCGAGTATATAACTGGGCCATGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033196.2-2991s21c1
Sequence:CCGGAGGGTTCCCTAATCGAGATTGCTCGAGCAATCTCGATTAGGGAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033196
VALIDATED
ZNFX1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, NFX1-type containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033196.2-1600s21c1
Sequence:CCGGCAACATCATTTCCGGGAAATACTCGAGTATTTCCCGGAAATGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033196.2-2407s21c1
Sequence:CCGGCAAGACTTACGTGGGTCTAAACTCGAGTTTAGACCCACGTAAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033196.2-2669s21c1
Sequence:CCGGCGGAGGGCCTATATGAGTATTCTCGAGAATACTCATATAGGCCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033196.2-6771s21c1
Sequence:CCGGTCTCCATGGCCCAGTTATATACTCGAGTATATAACTGGGCCATGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033196.2-2991s21c1
Sequence:CCGGAGGGTTCCCTAATCGAGATTGCTCGAGCAATCTCGATTAGGGAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks