EMAIL THIS PAGE TO A FRIEND

ZNHIT1

zinc finger, HIT-type containing 1

Synonyms: CG1I ZNFN4A1
UniProtKB ID: O43257, Q6IB12
Gene ID:
Mouse(70103) zinc finger, HIT domain containing 1
Rat(100360077) zinc finger, HIT-type containing 1
naked mole-rat(101701439) zinc finger, HIT-type containing 1
domestic guinea pig(100732940) zinc finger, HIT-type containing 1
cow(514997) zinc finger, HIT-type containing 1
sheep(101121482) zinc finger, HIT-type containing 1
Zebrafish(407699) zinc finger, HIT-type containing 1
dog(479729) zinc finger, HIT-type containing 1
domestic cat(101081432) zinc finger, HIT-type containing 1
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406996 Anti-ZNHIT1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV50537 Anti-ZNHIT1 antibody produced in rabbit affinity isolated antibody horse, mouse, rat, human, guinea pig, bovine, canine, zebrafish, rabbit
western blot pricing
HPA019043 Anti-ZNHIT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006349 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027318 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027318 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027318 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006349 Rosetta Predictions human pricing
NM_027318 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239377 predicted 557
2 SASI_Hs01_00239379 predicted 584
3 SASI_Hs02_00341389 predicted 951
4 SASI_Hs01_00239373 predicted 627
5 SASI_Hs02_00341390 predicted 647
6 SASI_Hs01_00239374 predicted 633
7 SASI_Hs01_00239375 predicted 765
8 SASI_Hs01_00239376 predicted 644
9 SASI_Hs01_00239378 predicted 772
10 SASI_Hs01_00239380 predicted 927
11 SASI_Hs01_00239381 predicted 952
12 SASI_Hs01_00239382 predicted 655
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027318 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182187 predicted 528
2 SASI_Mm01_00182188 predicted 531
3 SASI_Mm01_00182189 predicted 463
4 SASI_Mm01_00182190 predicted 577
5 SASI_Mm01_00182192 predicted 532
6 SASI_Mm01_00182193 predicted 377
7 SASI_Mm01_00182194 predicted 743
8 SASI_Mm01_00182195 predicted 540
9 SASI_Mm01_00182196 predicted 743
10 SASI_Mm02_00331941 predicted 452
11 SASI_Mm01_00182191 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006349
VALIDATED
ZNHIT1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, HIT-type containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006349.2-594s1c1
Sequence:CCGGCCTGGAGAATGACAACTTCCACTCGAGTGGAAGTTGTCATTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006349.2-651s1c1
Sequence:CCGGGAGACTGCCTCAGTTTGATGACTCGAGTCATCAAACTGAGGCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006349.2-598s1c1
Sequence:CCGGGAGAATGACAACTTCCAGGATCTCGAGATCCTGGAAGTTGTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006349.2-600s1c1
Sequence:CCGGGAATGACAACTTCCAGGATGACTCGAGTCATCCTGGAAGTTGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006349.2-673s1c2
Sequence:CCGGGATGCGGACACTGGAAAGAAACTCGAGTTTCTTTCCAGTGTCCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186657    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006349.2-1001s1c1
Sequence:CCGGGCCTTCAGAAAGACAGAATTTCTCGAGAAATTCTGTCTTTCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006349.2-673s21c1
Sequence:CCGGGATGCGGACACTGGAAAGAAACTCGAGTTTCTTTCCAGTGTCCGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006349.2-651s21c1
Sequence:CCGGGAGACTGCCTCAGTTTGATGACTCGAGTCATCAAACTGAGGCAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006349.2-1001s21c1
Sequence:CCGGGCCTTCAGAAAGACAGAATTTCTCGAGAAATTCTGTCTTTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006349.2-752s21c1
Sequence:CCGGTGTTGGAGGAGCAGAACTTGACTCGAGTCAAGTTCTGCTCCTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006349
VALIDATED
ZNHIT1 MISSION shRNA shRNA Plasmid DNA
zinc finger, HIT-type containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006349.2-594s1c1
Sequence:CCGGCCTGGAGAATGACAACTTCCACTCGAGTGGAAGTTGTCATTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006349.2-651s1c1
Sequence:CCGGGAGACTGCCTCAGTTTGATGACTCGAGTCATCAAACTGAGGCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006349.2-598s1c1
Sequence:CCGGGAGAATGACAACTTCCAGGATCTCGAGATCCTGGAAGTTGTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006349.2-600s1c1
Sequence:CCGGGAATGACAACTTCCAGGATGACTCGAGTCATCCTGGAAGTTGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006349.2-673s1c2
Sequence:CCGGGATGCGGACACTGGAAAGAAACTCGAGTTTCTTTCCAGTGTCCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186657    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006349.2-1001s1c1
Sequence:CCGGGCCTTCAGAAAGACAGAATTTCTCGAGAAATTCTGTCTTTCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006349.2-673s21c1
Sequence:CCGGGATGCGGACACTGGAAAGAAACTCGAGTTTCTTTCCAGTGTCCGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006349.2-651s21c1
Sequence:CCGGGAGACTGCCTCAGTTTGATGACTCGAGTCATCAAACTGAGGCAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006349.2-1001s21c1
Sequence:CCGGGCCTTCAGAAAGACAGAATTTCTCGAGAAATTCTGTCTTTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006349.2-752s21c1
Sequence:CCGGTGTTGGAGGAGCAGAACTTGACTCGAGTCAAGTTCTGCTCCTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006349
VALIDATED
ZNHIT1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, HIT-type containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006349.2-594s1c1
Sequence:CCGGCCTGGAGAATGACAACTTCCACTCGAGTGGAAGTTGTCATTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006349.2-651s1c1
Sequence:CCGGGAGACTGCCTCAGTTTGATGACTCGAGTCATCAAACTGAGGCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006349.2-598s1c1
Sequence:CCGGGAGAATGACAACTTCCAGGATCTCGAGATCCTGGAAGTTGTCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006349.2-600s1c1
Sequence:CCGGGAATGACAACTTCCAGGATGACTCGAGTCATCCTGGAAGTTGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006349.2-673s1c2
Sequence:CCGGGATGCGGACACTGGAAAGAAACTCGAGTTTCTTTCCAGTGTCCGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186657    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006349.2-1001s1c1
Sequence:CCGGGCCTTCAGAAAGACAGAATTTCTCGAGAAATTCTGTCTTTCTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006349.2-673s21c1
Sequence:CCGGGATGCGGACACTGGAAAGAAACTCGAGTTTCTTTCCAGTGTCCGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006349.2-651s21c1
Sequence:CCGGGAGACTGCCTCAGTTTGATGACTCGAGTCATCAAACTGAGGCAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323137    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006349.2-1001s21c1
Sequence:CCGGGCCTTCAGAAAGACAGAATTTCTCGAGAAATTCTGTCTTTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006349.2-752s21c1
Sequence:CCGGTGTTGGAGGAGCAGAACTTGACTCGAGTCAAGTTCTGCTCCTCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027318
VALIDATED
ZNHIT1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, HIT-type containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027318.1-598s1c1
Sequence:CCGGCTTTAAACTTCGCTTCCGGAACTCGAGTTCCGGAAGCGAAGTTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027318.1-554s1c1
Sequence:CCGGGATGCAGACACAGGAAAGAAACTCGAGTTTCTTTCCTGTGTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027318.1-587s1c1
Sequence:CCGGCGAGGTGACCACTTTAAACTTCTCGAGAAGTTTAAAGTGGTCACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027318.3-841s21c1
Sequence:CCGGTGGCATCAGGGAGAGAAAGTACTCGAGTACTTTCTCTCCCTGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027318.3-598s21c1
Sequence:CCGGTTTAAACTTCGCTTCCGGAAACTCGAGTTTCCGGAAGCGAAGTTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027318.3-818s21c1
Sequence:CCGGGTCTGAAGTGGACCGTGTAAACTCGAGTTTACACGGTCCACTTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027318.3-470s21c1
Sequence:CCGGAGGCATTGGAGAATGACAACTCTCGAGAGTTGTCATTCTCCAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027318.3-533s21c1
Sequence:CCGGGGCTACCTCAGTTTGATGATGCTCGAGCATCATCAAACTGAGGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027318
VALIDATED
ZNHIT1 MISSION shRNA shRNA Plasmid DNA
zinc finger, HIT-type containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027318.1-598s1c1
Sequence:CCGGCTTTAAACTTCGCTTCCGGAACTCGAGTTCCGGAAGCGAAGTTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027318.1-554s1c1
Sequence:CCGGGATGCAGACACAGGAAAGAAACTCGAGTTTCTTTCCTGTGTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027318.1-587s1c1
Sequence:CCGGCGAGGTGACCACTTTAAACTTCTCGAGAAGTTTAAAGTGGTCACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027318.3-841s21c1
Sequence:CCGGTGGCATCAGGGAGAGAAAGTACTCGAGTACTTTCTCTCCCTGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027318.3-598s21c1
Sequence:CCGGTTTAAACTTCGCTTCCGGAAACTCGAGTTTCCGGAAGCGAAGTTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027318.3-818s21c1
Sequence:CCGGGTCTGAAGTGGACCGTGTAAACTCGAGTTTACACGGTCCACTTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027318.3-470s21c1
Sequence:CCGGAGGCATTGGAGAATGACAACTCTCGAGAGTTGTCATTCTCCAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027318.3-533s21c1
Sequence:CCGGGGCTACCTCAGTTTGATGATGCTCGAGCATCATCAAACTGAGGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027318
VALIDATED
ZNHIT1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, HIT-type containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027318.1-598s1c1
Sequence:CCGGCTTTAAACTTCGCTTCCGGAACTCGAGTTCCGGAAGCGAAGTTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027318.1-554s1c1
Sequence:CCGGGATGCAGACACAGGAAAGAAACTCGAGTTTCTTTCCTGTGTCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027318.1-587s1c1
Sequence:CCGGCGAGGTGACCACTTTAAACTTCTCGAGAAGTTTAAAGTGGTCACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241195    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027318.3-841s21c1
Sequence:CCGGTGGCATCAGGGAGAGAAAGTACTCGAGTACTTTCTCTCCCTGATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027318.3-598s21c1
Sequence:CCGGTTTAAACTTCGCTTCCGGAAACTCGAGTTTCCGGAAGCGAAGTTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027318.3-818s21c1
Sequence:CCGGGTCTGAAGTGGACCGTGTAAACTCGAGTTTACACGGTCCACTTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027318.3-470s21c1
Sequence:CCGGAGGCATTGGAGAATGACAACTCTCGAGAGTTGTCATTCTCCAATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027318.3-533s21c1
Sequence:CCGGGGCTACCTCAGTTTGATGATGCTCGAGCATCATCAAACTGAGGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks