EMAIL THIS PAGE TO A FRIEND

ZNHIT2

zinc finger, HIT-type containing 2

Synonyms: C11orf5 FON
UniProtKB ID: Q9UHR6, Q3SY14, Q8IUV0
Gene ID:
Mouse(29805) zinc finger, HIT domain containing 2
Rat(309177) zinc finger, HIT-type containing 2
Zebrafish(777606) zinc finger, HIT-type containing 2
domestic cat(101096413) zinc finger, HIT-type containing 2
dog(483749) zinc finger, HIT-type containing 2
cow(539138) zinc finger, HIT-type containing 2
sheep(101120968) zinc finger, HIT-type containing 2
domestic guinea pig(100725731) zinc finger, HIT-type containing 2
naked mole-rat(101699224) zinc finger, HIT-type containing 2
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013859 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013859 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013859 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014205 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014205 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014205 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152431 MISSION® esiRNA esiRNA human ZNHIT2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014205 Rosetta Predictions human pricing
NM_001107574 Rosetta Predictions rat pricing
NM_013859 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216753 predicted 691
2 SASI_Hs01_00216754 predicted 997
3 SASI_Hs01_00216755 predicted 685
4 SASI_Hs01_00216756 predicted 940
5 SASI_Hs01_00216757 predicted 809
6 SASI_Hs01_00216758 predicted 1012
7 SASI_Hs01_00216759 predicted 730
8 SASI_Hs01_00216760 predicted 1003
9 SASI_Hs01_00216761 predicted 716
10 SASI_Hs01_00216762 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107574 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230175 predicted 927
2 SASI_Rn02_00230176 predicted 780
3 SASI_Rn02_00230177 predicted 736
4 SASI_Rn02_00230178 predicted 1008
5 SASI_Rn02_00230179 predicted 660
6 SASI_Rn02_00230180 predicted 666
7 SASI_Rn02_00230181 predicted 914
8 SASI_Rn02_00230182 predicted 980
9 SASI_Rn02_00230183 predicted 685
10 SASI_Rn02_00230184 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013859 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106916 predicted 652
2 SASI_Mm01_00106917 predicted 994
3 SASI_Mm01_00106918 predicted 651
4 SASI_Mm01_00106919 predicted 763
5 SASI_Mm01_00106920 predicted 446
6 SASI_Mm01_00106921 predicted 220
7 SASI_Mm01_00106922 predicted 876
8 SASI_Mm01_00106923 predicted 299
9 SASI_Mm01_00106924 predicted 708
10 SASI_Mm01_00106925 predicted 333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013859
VALIDATED
ZNHIT2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, HIT-type containing 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013859.2-308s21c1
Sequence:CCGGTGGACTTTGGGAACGTTTAACCTCGAGGTTAAACGTTCCCAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013859.2-867s21c1
Sequence:CCGGATGCAAGAAGTTGCCCGAATCCTCGAGGATTCGGGCAACTTCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013859.2-898s21c1
Sequence:CCGGAGGGTCCAGTCAATCAGAAAGCTCGAGCTTTCTGATTGACTGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013859.2-673s21c1
Sequence:CCGGCTCATACTCTCGCCCTGTATCCTCGAGGATACAGGGCGAGAGTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013859.1-779s1c1
Sequence:CCGGGCAAGTCTTTGGCTCTACAGACTCGAGTCTGTAGAGCCAAAGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013859.1-312s1c1
Sequence:CCGGCTTTCTGGACTTTGGGAACGTCTCGAGACGTTCCCAAAGTCCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013859.1-684s1c1
Sequence:CCGGCATACTCTCGCCCTGTATCATCTCGAGATGATACAGGGCGAGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013859
VALIDATED
ZNHIT2 MISSION shRNA shRNA Plasmid DNA
zinc finger, HIT-type containing 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013859.2-308s21c1
Sequence:CCGGTGGACTTTGGGAACGTTTAACCTCGAGGTTAAACGTTCCCAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013859.2-867s21c1
Sequence:CCGGATGCAAGAAGTTGCCCGAATCCTCGAGGATTCGGGCAACTTCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013859.2-898s21c1
Sequence:CCGGAGGGTCCAGTCAATCAGAAAGCTCGAGCTTTCTGATTGACTGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013859.2-673s21c1
Sequence:CCGGCTCATACTCTCGCCCTGTATCCTCGAGGATACAGGGCGAGAGTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013859.1-779s1c1
Sequence:CCGGGCAAGTCTTTGGCTCTACAGACTCGAGTCTGTAGAGCCAAAGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013859.1-312s1c1
Sequence:CCGGCTTTCTGGACTTTGGGAACGTCTCGAGACGTTCCCAAAGTCCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013859.1-684s1c1
Sequence:CCGGCATACTCTCGCCCTGTATCATCTCGAGATGATACAGGGCGAGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013859
VALIDATED
ZNHIT2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, HIT-type containing 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013859.2-308s21c1
Sequence:CCGGTGGACTTTGGGAACGTTTAACCTCGAGGTTAAACGTTCCCAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013859.2-867s21c1
Sequence:CCGGATGCAAGAAGTTGCCCGAATCCTCGAGGATTCGGGCAACTTCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013859.2-898s21c1
Sequence:CCGGAGGGTCCAGTCAATCAGAAAGCTCGAGCTTTCTGATTGACTGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013859.2-673s21c1
Sequence:CCGGCTCATACTCTCGCCCTGTATCCTCGAGGATACAGGGCGAGAGTATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196169    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013859.1-779s1c1
Sequence:CCGGGCAAGTCTTTGGCTCTACAGACTCGAGTCTGTAGAGCCAAAGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013859.1-312s1c1
Sequence:CCGGCTTTCTGGACTTTGGGAACGTCTCGAGACGTTCCCAAAGTCCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013859.1-684s1c1
Sequence:CCGGCATACTCTCGCCCTGTATCATCTCGAGATGATACAGGGCGAGAGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014205
ZNHIT2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, HIT-type containing 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014205.2-461s21c1
Sequence:CCGGTTCTGGAGGAGCTGGATAATGCTCGAGCATTATCCAGCTCCTCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014205.2-941s21c1
Sequence:CCGGCGACCAACCAGAAAGGCTACACTCGAGTGTAGCCTTTCTGGTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014205.2-1026s21c1
Sequence:CCGGAGAAGAGCGAGATCATCTTTACTCGAGTAAAGATGATCTCGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014205.2-714s21c1
Sequence:CCGGGCATACTCTCGCCCTGTATCACTCGAGTGATACAGGGCGAGAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014205.2-103s21c1
Sequence:CCGGTACACCTGCCCTCGCTGTAATCTCGAGATTACAGCGAGGGCAGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014205.2-1025s1c1
Sequence:CCGGGAGAAGAGCGAGATCATCTTTCTCGAGAAAGATGATCTCGCTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014205
ZNHIT2 MISSION shRNA shRNA Plasmid DNA
zinc finger, HIT-type containing 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014205.2-461s21c1
Sequence:CCGGTTCTGGAGGAGCTGGATAATGCTCGAGCATTATCCAGCTCCTCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014205.2-941s21c1
Sequence:CCGGCGACCAACCAGAAAGGCTACACTCGAGTGTAGCCTTTCTGGTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014205.2-1026s21c1
Sequence:CCGGAGAAGAGCGAGATCATCTTTACTCGAGTAAAGATGATCTCGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014205.2-714s21c1
Sequence:CCGGGCATACTCTCGCCCTGTATCACTCGAGTGATACAGGGCGAGAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014205.2-103s21c1
Sequence:CCGGTACACCTGCCCTCGCTGTAATCTCGAGATTACAGCGAGGGCAGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014205.2-1025s1c1
Sequence:CCGGGAGAAGAGCGAGATCATCTTTCTCGAGAAAGATGATCTCGCTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014205
ZNHIT2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, HIT-type containing 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014205.2-461s21c1
Sequence:CCGGTTCTGGAGGAGCTGGATAATGCTCGAGCATTATCCAGCTCCTCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014205.2-941s21c1
Sequence:CCGGCGACCAACCAGAAAGGCTACACTCGAGTGTAGCCTTTCTGGTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014205.2-1026s21c1
Sequence:CCGGAGAAGAGCGAGATCATCTTTACTCGAGTAAAGATGATCTCGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014205.2-714s21c1
Sequence:CCGGGCATACTCTCGCCCTGTATCACTCGAGTGATACAGGGCGAGAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014205.2-103s21c1
Sequence:CCGGTACACCTGCCCTCGCTGTAATCTCGAGATTACAGCGAGGGCAGGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014205.2-1025s1c1
Sequence:CCGGGAGAAGAGCGAGATCATCTTTCTCGAGAAAGATGATCTCGCTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks