EMAIL THIS PAGE TO A FRIEND

ZNHIT3

zinc finger, HIT-type containing 3

Synonyms: TRIP3
UniProtKB ID: Q15649, A8K493, Q8WVJ3
Gene ID:
Mouse(448850) zinc finger, HIT type 3
Rat(497975) zinc finger, HIT-type containing 3
naked mole-rat(101701847) zinc finger, HIT-type containing 3
domestic guinea pig(100732662) zinc finger, HIT-type containing 3
cow(504662) zinc finger, HIT-type containing 3
sheep(101110250) zinc finger, HIT-type containing 3
Zebrafish(393243) zinc finger, HIT-type containing 3
dog(480592) zinc finger, HIT-type containing 3
chicken(100859083) zinc finger, HIT-type containing 3
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005223 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005223 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005223 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004773 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004773 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004773 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033577 Rosetta Predictions human pricing
NM_004773 Rosetta Predictions human pricing
XM_001081104 Rosetta Predictions rat pricing
XM_573169 Rosetta Predictions rat pricing
NM_001005223 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033577 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195533 predicted 202
2 SASI_Hs01_00195534 predicted 202
3 SASI_Hs01_00195535 predicted 151
4 SASI_Hs01_00195536 predicted 93
5 SASI_Hs01_00195537 predicted 196
6 SASI_Hs01_00195538 predicted 153
7 SASI_Hs01_00195539 predicted 199
8 SASI_Hs01_00195540 predicted 197
9 SASI_Hs01_00195541 predicted 145
10 SASI_Hs01_00195542 predicted 95
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004773 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185502 predicted 722
2 SASI_Hs01_00185503 predicted 512
3 SASI_Hs02_00338279 predicted 354
4 SASI_Hs02_00338280 predicted 359
5 SASI_Hs01_00185504 predicted 479
6 SASI_Hs01_00185505 predicted 452
7 SASI_Hs01_00185506 predicted 397
8 SASI_Hs01_00185507 predicted 688
9 SASI_Hs01_00185508 predicted 678
10 SASI_Hs01_00185509 predicted 527
11 SASI_Hs01_00185510 predicted 380
12 SASI_Hs01_00185511 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370591 predicted 132
2 SASI_Rn02_00370592 predicted 198
3 SASI_Rn02_00370593 predicted 185
4 SASI_Rn02_00370594 predicted 330
5 SASI_Rn02_00370595 predicted 184
6 SASI_Rn02_00370596 predicted 156
7 SASI_Rn02_00370597 predicted 252
8 SASI_Rn02_00370598 predicted 14
9 SASI_Rn02_00370599 predicted 323
10 SASI_Rn02_00370600 predicted 162
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573169 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399934 predicted 136
2 SASI_Rn02_00399935 predicted 191
3 SASI_Rn02_00399936 predicted 186
4 SASI_Rn02_00399937 predicted 323
5 SASI_Rn02_00399938 predicted 179
6 SASI_Rn02_00399939 predicted 157
7 SASI_Rn02_00399940 predicted 257
8 SASI_Rn02_00399941 predicted 14
9 SASI_Rn02_00399942 predicted 324
10 SASI_Rn02_00399943 predicted 163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005223 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152720 predicted 718
2 SASI_Mm01_00152722 predicted 714
3 SASI_Mm01_00152723 predicted 218
4 SASI_Mm01_00152725 predicted 722
5 SASI_Mm02_00286556 predicted 587
6 SASI_Mm01_00152728 predicted 454
7 SASI_Mm02_00286557 predicted 213
8 SASI_Mm02_00286558 predicted 205
9 SASI_Mm01_00152719 predicted 347
10 SASI_Mm01_00152721 predicted 280
11 SASI_Mm01_00152724 predicted 293
12 SASI_Mm01_00152726 predicted 328
13 SASI_Mm01_00152727 predicted 300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005223
VALIDATED
ZNHIT3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, HIT-type containing 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005223.1-714s1c1
Sequence:CCGGGCAGAGGATCTGACAGTCTTTCTCGAGAAAGACTGTCAGATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005223.1-54s1c1
Sequence:CCGGGTCTGTTTGGAGAAGCCGAAACTCGAGTTTCGGCTTCTCCAAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005223.1-287s1c1
Sequence:CCGGTCTAGGTGAATCGGAAACTTTCTCGAGAAAGTTTCCGATTCACCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005223.1-339s1c1
Sequence:CCGGCAGTTGATGATTAGCCTCGATCTCGAGATCGAGGCTAATCATCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005223.1-228s1c1
Sequence:CCGGGCTGATTTCCTCAACAGTGATCTCGAGATCACTGTTGAGGAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005223.2-712s21c1
Sequence:CCGGGCAGAGGATCTGACAGTCTTTCTCGAGAAAGACTGTCAGATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005223.2-451s21c1
Sequence:CCGGTCCCAGAAGAGGGATTCCTAACTCGAGTTAGGAATCCCTCTTCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005223.2-416s21c1
Sequence:CCGGAGTTTGCAGACTGCTGTTTAGCTCGAGCTAAACAGCAGTCTGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005223.2-285s21c1
Sequence:CCGGTCTAGGTGAATCGGAAACTTTCTCGAGAAAGTTTCCGATTCACCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005223.2-226s21c1
Sequence:CCGGGCTGATTTCCTCAACAGTGATCTCGAGATCACTGTTGAGGAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005223
VALIDATED
ZNHIT3 MISSION shRNA shRNA Plasmid DNA
zinc finger, HIT-type containing 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005223.1-714s1c1
Sequence:CCGGGCAGAGGATCTGACAGTCTTTCTCGAGAAAGACTGTCAGATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005223.1-54s1c1
Sequence:CCGGGTCTGTTTGGAGAAGCCGAAACTCGAGTTTCGGCTTCTCCAAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005223.1-287s1c1
Sequence:CCGGTCTAGGTGAATCGGAAACTTTCTCGAGAAAGTTTCCGATTCACCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005223.1-339s1c1
Sequence:CCGGCAGTTGATGATTAGCCTCGATCTCGAGATCGAGGCTAATCATCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005223.1-228s1c1
Sequence:CCGGGCTGATTTCCTCAACAGTGATCTCGAGATCACTGTTGAGGAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005223.2-712s21c1
Sequence:CCGGGCAGAGGATCTGACAGTCTTTCTCGAGAAAGACTGTCAGATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005223.2-451s21c1
Sequence:CCGGTCCCAGAAGAGGGATTCCTAACTCGAGTTAGGAATCCCTCTTCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005223.2-416s21c1
Sequence:CCGGAGTTTGCAGACTGCTGTTTAGCTCGAGCTAAACAGCAGTCTGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005223.2-285s21c1
Sequence:CCGGTCTAGGTGAATCGGAAACTTTCTCGAGAAAGTTTCCGATTCACCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005223.2-226s21c1
Sequence:CCGGGCTGATTTCCTCAACAGTGATCTCGAGATCACTGTTGAGGAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005223
VALIDATED
ZNHIT3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, HIT-type containing 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095604    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005223.1-714s1c1
Sequence:CCGGGCAGAGGATCTGACAGTCTTTCTCGAGAAAGACTGTCAGATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005223.1-54s1c1
Sequence:CCGGGTCTGTTTGGAGAAGCCGAAACTCGAGTTTCGGCTTCTCCAAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005223.1-287s1c1
Sequence:CCGGTCTAGGTGAATCGGAAACTTTCTCGAGAAAGTTTCCGATTCACCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005223.1-339s1c1
Sequence:CCGGCAGTTGATGATTAGCCTCGATCTCGAGATCGAGGCTAATCATCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005223.1-228s1c1
Sequence:CCGGGCTGATTTCCTCAACAGTGATCTCGAGATCACTGTTGAGGAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005223.2-712s21c1
Sequence:CCGGGCAGAGGATCTGACAGTCTTTCTCGAGAAAGACTGTCAGATCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005223.2-451s21c1
Sequence:CCGGTCCCAGAAGAGGGATTCCTAACTCGAGTTAGGAATCCCTCTTCTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005223.2-416s21c1
Sequence:CCGGAGTTTGCAGACTGCTGTTTAGCTCGAGCTAAACAGCAGTCTGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005223.2-285s21c1
Sequence:CCGGTCTAGGTGAATCGGAAACTTTCTCGAGAAAGTTTCCGATTCACCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005223.2-226s21c1
Sequence:CCGGGCTGATTTCCTCAACAGTGATCTCGAGATCACTGTTGAGGAAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004773
VALIDATED
ZNHIT3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, HIT-type containing 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004773.1-293s1c1
Sequence:CCGGCAGAGTTTCTTTGCAGAATTTCTCGAGAAATTCTGCAAAGAAACTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004773.1-270s1c1
Sequence:CCGGCTCAATAGTGATGAGGAAGAACTCGAGTTCTTCCTCATCACTATTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004773.1-421s1c1
Sequence:CCGGGAGCTTACATGCAAGAGCCTTCTCGAGAAGGCTCTTGCATGTAAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004773.1-438s1c1
Sequence:CCGGCCTTTGTTTGTGGAGTTTGCACTCGAGTGCAAACTCCACAAACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004773.2-303s21c1
Sequence:CCGGCTCAATAGTGATGAGGAAGAACTCGAGTTCTTCCTCATCACTATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004773.2-471s21c1
Sequence:CCGGCCTTTGTTTGTGGAGTTTGCACTCGAGTGCAAACTCCACAAACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004773.2-326s21c1
Sequence:CCGGCAGAGTTTCTTTGCAGAATTTCTCGAGAAATTCTGCAAAGAAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004773.2-531s21c1
Sequence:CCGGGAGTCTTAAGATGGATTATTGCTCGAGCAATAATCCATCTTAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004773.2-797s21c1
Sequence:CCGGACAGTTGATAGACATCATAAACTCGAGTTTATGATGTCTATCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004773
VALIDATED
ZNHIT3 MISSION shRNA shRNA Plasmid DNA
zinc finger, HIT-type containing 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004773.1-293s1c1
Sequence:CCGGCAGAGTTTCTTTGCAGAATTTCTCGAGAAATTCTGCAAAGAAACTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004773.1-270s1c1
Sequence:CCGGCTCAATAGTGATGAGGAAGAACTCGAGTTCTTCCTCATCACTATTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004773.1-421s1c1
Sequence:CCGGGAGCTTACATGCAAGAGCCTTCTCGAGAAGGCTCTTGCATGTAAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004773.1-438s1c1
Sequence:CCGGCCTTTGTTTGTGGAGTTTGCACTCGAGTGCAAACTCCACAAACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004773.2-303s21c1
Sequence:CCGGCTCAATAGTGATGAGGAAGAACTCGAGTTCTTCCTCATCACTATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004773.2-471s21c1
Sequence:CCGGCCTTTGTTTGTGGAGTTTGCACTCGAGTGCAAACTCCACAAACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004773.2-326s21c1
Sequence:CCGGCAGAGTTTCTTTGCAGAATTTCTCGAGAAATTCTGCAAAGAAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004773.2-531s21c1
Sequence:CCGGGAGTCTTAAGATGGATTATTGCTCGAGCAATAATCCATCTTAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004773.2-797s21c1
Sequence:CCGGACAGTTGATAGACATCATAAACTCGAGTTTATGATGTCTATCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004773
VALIDATED
ZNHIT3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, HIT-type containing 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004773.1-293s1c1
Sequence:CCGGCAGAGTTTCTTTGCAGAATTTCTCGAGAAATTCTGCAAAGAAACTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004773.1-270s1c1
Sequence:CCGGCTCAATAGTGATGAGGAAGAACTCGAGTTCTTCCTCATCACTATTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004773.1-421s1c1
Sequence:CCGGGAGCTTACATGCAAGAGCCTTCTCGAGAAGGCTCTTGCATGTAAGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004773.1-438s1c1
Sequence:CCGGCCTTTGTTTGTGGAGTTTGCACTCGAGTGCAAACTCCACAAACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004773.2-303s21c1
Sequence:CCGGCTCAATAGTGATGAGGAAGAACTCGAGTTCTTCCTCATCACTATTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_004773.2-471s21c1
Sequence:CCGGCCTTTGTTTGTGGAGTTTGCACTCGAGTGCAAACTCCACAAACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004773.2-326s21c1
Sequence:CCGGCAGAGTTTCTTTGCAGAATTTCTCGAGAAATTCTGCAAAGAAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_004773.2-531s21c1
Sequence:CCGGGAGTCTTAAGATGGATTATTGCTCGAGCAATAATCCATCTTAAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004773.2-797s21c1
Sequence:CCGGACAGTTGATAGACATCATAAACTCGAGTTTATGATGTCTATCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks