EMAIL THIS PAGE TO A FRIEND

ZNHIT6

zinc finger, HIT-type containing 6

Synonyms: BCD1 C1orf181 NY-BR-75
Gene ID:
Mouse(229937) zinc finger, HIT type 6
Rat(292160) zinc finger, HIT-type containing 6
chicken(424527) zinc finger, HIT-type containing 6
domestic cat(101092449) zinc finger, HIT-type containing 6
dog(479966) zinc finger, HIT-type containing 6
cow(505578) zinc finger, HIT-type containing 6
sheep(101114320) zinc finger, HIT-type containing 6
domestic guinea pig(100728935) zinc finger, HIT-type containing 6
naked mole-rat(101710646) zinc finger, HIT-type containing 6
136 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017953 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017953 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017953 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081094 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081094 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081094 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017953 Rosetta Predictions human pricing
NM_001106203 Rosetta Predictions rat pricing
NM_001081094 Rosetta Predictions mouse pricing
XM_131228 Rosetta Predictions mouse pricing
XM_897234 Rosetta Predictions mouse pricing
XM_897243 Rosetta Predictions mouse pricing
XM_897253 Rosetta Predictions mouse pricing
XM_897259 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350983 predicted 1291
2 SASI_Hs01_00166879 predicted 981
3 SASI_Hs01_00166880 predicted 1572
4 SASI_Hs01_00166881 predicted 819
5 SASI_Hs01_00166882 predicted 955
6 SASI_Hs01_00166883 predicted 1182
7 SASI_Hs01_00166884 predicted 844
8 SASI_Hs01_00166885 predicted 1190
9 SASI_Hs02_00350984 predicted 1347
10 SASI_Hs01_00166887 predicted 1493
11 SASI_Hs01_00166878 predicted 1526
12 SASI_Hs01_00166886 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106203 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216648 predicted 1301
2 SASI_Rn02_00216649 predicted 502
3 SASI_Rn02_00216650 predicted 902
4 SASI_Rn02_00216651 predicted 1104
5 SASI_Rn02_00216652 predicted 366
6 SASI_Rn02_00216653 predicted 277
7 SASI_Rn02_00216654 predicted 1170
8 SASI_Rn02_00216655 predicted 257
9 SASI_Rn02_00216656 predicted 1154
10 SASI_Rn02_00216657 predicted 780
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081094 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295121 predicted 1074
2 SASI_Mm02_00295122 predicted 1192
3 SASI_Mm02_00295123 predicted 1457
4 SASI_Mm02_00295124 predicted 1299
5 SASI_Mm02_00295125 predicted 1285
6 SASI_Mm02_00295126 predicted 897
7 SASI_Mm02_00295127 predicted 1230
8 SASI_Mm02_00295128 predicted 989
9 SASI_Mm02_00295129 predicted 1090
10 SASI_Mm02_00295130 predicted 1180
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266352 predicted 1084
2 SASI_Mm01_00266353 predicted 1200
3 SASI_Mm01_00266354 predicted 1414
4 SASI_Mm01_00266355 predicted 1464
5 SASI_Mm01_00266356 predicted 1300
6 SASI_Mm01_00266357 predicted 910
7 SASI_Mm01_00266358 predicted 1236
8 SASI_Mm01_00266359 predicted 1000
9 SASI_Mm01_00266360 predicted 1091
10 SASI_Mm01_00266361 predicted 1181
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897234 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236523 predicted 426
2 SASI_Mm01_00236524 predicted 533
3 SASI_Mm01_00236525 predicted 801
4 SASI_Mm01_00236526 predicted 645
5 SASI_Mm01_00236527 predicted 582
6 SASI_Mm01_00236528 predicted 335
7 SASI_Mm01_00236529 predicted 439
8 SASI_Mm01_00236530 predicted 521
9 SASI_Mm01_00236531 predicted 1125
10 SASI_Mm01_00236532 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263183 predicted 933
2 SASI_Mm01_00263184 predicted 745
3 SASI_Mm01_00263185 predicted 925
4 SASI_Mm01_00263186 predicted 366
5 SASI_Mm01_00263187 predicted 411
6 SASI_Mm01_00263188 predicted 926
7 SASI_Mm01_00263189 predicted 419
8 SASI_Mm01_00263190 predicted 921
9 SASI_Mm01_00263191 predicted 740
10 SASI_Mm01_00263192 predicted 421
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897253 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284066 predicted 501
2 SASI_Mm01_00284067 predicted 604
3 SASI_Mm01_00284068 predicted 828
4 SASI_Mm01_00284069 predicted 880
5 SASI_Mm01_00284070 predicted 711
6 SASI_Mm01_00284071 predicted 317
7 SASI_Mm01_00284072 predicted 657
8 SASI_Mm01_00284073 predicted 409
9 SASI_Mm01_00284074 predicted 505
10 SASI_Mm01_00284075 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_897259 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213882 predicted 532
2 SASI_Mm01_00213883 predicted 646
3 SASI_Mm01_00213884 predicted 225
4 SASI_Mm01_00213885 predicted 911
5 SASI_Mm01_00213886 predicted 743
6 SASI_Mm01_00213887 predicted 348
7 SASI_Mm01_00213888 predicted 690
8 SASI_Mm01_00213889 predicted 543
9 SASI_Mm01_00213890 predicted 630
10 SASI_Mm01_00213891 predicted 210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017953
VALIDATED
ZNHIT6 MISSION shRNA Bacterial Glycerol Stock
zinc finger, HIT-type containing 6
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017953.2-1070s21c1
Sequence:CCGGTGCCCGGAGGCAAGGTATTAACTCGAGTTAATACCTTGCCTCCGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017953.2-988s21c1
Sequence:CCGGCAAGAACAGCGGACCATATTTCTCGAGAAATATGGTCCGCTGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017953.2-894s21c1
Sequence:CCGGTGTAATGGAGTTCGAGATAAACTCGAGTTTATCTCGAACTCCATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017953.2-1767s21c1
Sequence:CCGGTGATCAGCATAGTACTTATTACTCGAGTAATAAGTACTATGCTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017953.2-829s21c1
Sequence:CCGGGTCCACGTTGTATGCGATATTCTCGAGAATATCGCATACAACGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017953.2-339s1c1
Sequence:CCGGGAGGAAATACCGATGGACCTACTCGAGTAGGTCCATCGGTATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017953.2-1522s1c1
Sequence:CCGGCCAAGAACGTTGGCAATGAAACTCGAGTTTCATTGCCAACGTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017953.2-860s1c1
Sequence:CCGGGCCTTGTGTAAAGAAACACAACTCGAGTTGTGTTTCTTTACACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017953.2-838s1c1
Sequence:CCGGGTATGCGATATTCCTGCAGTTCTCGAGAACTGCAGGAATATCGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130954    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017953.2-2506s1c1
Sequence:CCGGCCTAGCCCACTCTCATCATTACTCGAGTAATGATGAGAGTGGGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017953.2-996s1c1
Sequence:CCGGGCGGACCATATTTCTAGAGATCTCGAGATCTCTAGAAATATGGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017953
VALIDATED
ZNHIT6 MISSION shRNA shRNA Plasmid DNA
zinc finger, HIT-type containing 6
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017953.2-1070s21c1
Sequence:CCGGTGCCCGGAGGCAAGGTATTAACTCGAGTTAATACCTTGCCTCCGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017953.2-988s21c1
Sequence:CCGGCAAGAACAGCGGACCATATTTCTCGAGAAATATGGTCCGCTGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017953.2-894s21c1
Sequence:CCGGTGTAATGGAGTTCGAGATAAACTCGAGTTTATCTCGAACTCCATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017953.2-1767s21c1
Sequence:CCGGTGATCAGCATAGTACTTATTACTCGAGTAATAAGTACTATGCTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017953.2-829s21c1
Sequence:CCGGGTCCACGTTGTATGCGATATTCTCGAGAATATCGCATACAACGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017953.2-339s1c1
Sequence:CCGGGAGGAAATACCGATGGACCTACTCGAGTAGGTCCATCGGTATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017953.2-1522s1c1
Sequence:CCGGCCAAGAACGTTGGCAATGAAACTCGAGTTTCATTGCCAACGTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017953.2-860s1c1
Sequence:CCGGGCCTTGTGTAAAGAAACACAACTCGAGTTGTGTTTCTTTACACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017953.2-838s1c1
Sequence:CCGGGTATGCGATATTCCTGCAGTTCTCGAGAACTGCAGGAATATCGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130954    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017953.2-2506s1c1
Sequence:CCGGCCTAGCCCACTCTCATCATTACTCGAGTAATGATGAGAGTGGGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017953.2-996s1c1
Sequence:CCGGGCGGACCATATTTCTAGAGATCTCGAGATCTCTAGAAATATGGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017953
VALIDATED
ZNHIT6 MISSION shRNA Lentiviral Transduction Particles
zinc finger, HIT-type containing 6
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017953.2-1070s21c1
Sequence:CCGGTGCCCGGAGGCAAGGTATTAACTCGAGTTAATACCTTGCCTCCGGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017953.2-988s21c1
Sequence:CCGGCAAGAACAGCGGACCATATTTCTCGAGAAATATGGTCCGCTGTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017953.2-894s21c1
Sequence:CCGGTGTAATGGAGTTCGAGATAAACTCGAGTTTATCTCGAACTCCATTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017953.2-1767s21c1
Sequence:CCGGTGATCAGCATAGTACTTATTACTCGAGTAATAAGTACTATGCTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017953.2-829s21c1
Sequence:CCGGGTCCACGTTGTATGCGATATTCTCGAGAATATCGCATACAACGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017953.2-339s1c1
Sequence:CCGGGAGGAAATACCGATGGACCTACTCGAGTAGGTCCATCGGTATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017953.2-1522s1c1
Sequence:CCGGCCAAGAACGTTGGCAATGAAACTCGAGTTTCATTGCCAACGTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017953.2-860s1c1
Sequence:CCGGGCCTTGTGTAAAGAAACACAACTCGAGTTGTGTTTCTTTACACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017953.2-838s1c1
Sequence:CCGGGTATGCGATATTCCTGCAGTTCTCGAGAACTGCAGGAATATCGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130954    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017953.2-2506s1c1
Sequence:CCGGCCTAGCCCACTCTCATCATTACTCGAGTAATGATGAGAGTGGGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017953.2-996s1c1
Sequence:CCGGGCGGACCATATTTCTAGAGATCTCGAGATCTCTAGAAATATGGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081094
ZNHIT6 MISSION shRNA Bacterial Glycerol Stock
zinc finger, HIT-type containing 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081094.1-380s21c1
Sequence:CCGGGTAGTAGACTGGTCGGATTTACTCGAGTAAATCCGACCAGTCTACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081094.1-2323s21c1
Sequence:CCGGGCCAGCTCATTTGGCTAATATCTCGAGATATTAGCCAAATGAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081094.1-1463s21c1
Sequence:CCGGGTGTTGAGAGGATCTAGTAATCTCGAGATTACTAGATCCTCTCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081094.1-663s21c1
Sequence:CCGGTGATGGATGCAGCGCCTATAACTCGAGTTATAGGCGCTGCATCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081094.1-1436s21c1
Sequence:CCGGATCATTGAGTACCCGACTTTGCTCGAGCAAAGTCGGGTACTCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081094
ZNHIT6 MISSION shRNA shRNA Plasmid DNA
zinc finger, HIT-type containing 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081094.1-380s21c1
Sequence:CCGGGTAGTAGACTGGTCGGATTTACTCGAGTAAATCCGACCAGTCTACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081094.1-2323s21c1
Sequence:CCGGGCCAGCTCATTTGGCTAATATCTCGAGATATTAGCCAAATGAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081094.1-1463s21c1
Sequence:CCGGGTGTTGAGAGGATCTAGTAATCTCGAGATTACTAGATCCTCTCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081094.1-663s21c1
Sequence:CCGGTGATGGATGCAGCGCCTATAACTCGAGTTATAGGCGCTGCATCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081094.1-1436s21c1
Sequence:CCGGATCATTGAGTACCCGACTTTGCTCGAGCAAAGTCGGGTACTCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081094
ZNHIT6 MISSION shRNA Lentiviral Transduction Particles
zinc finger, HIT-type containing 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081094.1-380s21c1
Sequence:CCGGGTAGTAGACTGGTCGGATTTACTCGAGTAAATCCGACCAGTCTACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081094.1-2323s21c1
Sequence:CCGGGCCAGCTCATTTGGCTAATATCTCGAGATATTAGCCAAATGAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081094.1-1463s21c1
Sequence:CCGGGTGTTGAGAGGATCTAGTAATCTCGAGATTACTAGATCCTCTCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081094.1-663s21c1
Sequence:CCGGTGATGGATGCAGCGCCTATAACTCGAGTTATAGGCGCTGCATCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081094.1-1436s21c1
Sequence:CCGGATCATTGAGTACCCGACTTTGCTCGAGCAAAGTCGGGTACTCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks