EMAIL THIS PAGE TO A FRIEND

ZNRD1

zinc ribbon domain containing 1

Synonyms: HTEX-6 Rpa12 TEX6 ZR14 hZR14 tctex-6
UniProtKB ID: Q9P1U0
Gene ID:
Human(30834) Summary: This gene encodes a DNA-directed RNA polymerase I subunit. The encoded protein contains two potential zinc-binding motifs and may play a role in regulation of cell proliferation. The encoded protein may be involved in cancer and human immunodeficiency virus progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(66136) zinc ribbon domain containing, 1
Rat(361784) zinc ribbon domain containing 1
naked mole-rat(101716362) zinc ribbon domain containing 1
domestic guinea pig(100735316) zinc ribbon domain containing 1
cow(535288) zinc ribbon domain containing 1
sheep(101112769) zinc ribbon domain containing 1
Zebrafish(541428) zinc ribbon domain containing 1
domestic cat(101097147) zinc ribbon domain containing 1
dog(488343) zinc ribbon domain containing 1
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014596 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014596 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014596 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023162 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023162 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023162 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU016591 MISSION® esiRNA esiRNA targeting mouse Znrd1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014596 Rosetta Predictions human pricing
NM_170783 Rosetta Predictions human pricing
NM_213567 Rosetta Predictions rat pricing
NM_023162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163966 predicted 472
2 SASI_Hs01_00163967 predicted 444
3 SASI_Hs01_00163968 predicted 418
4 SASI_Hs01_00163969 predicted 463
5 SASI_Hs01_00163970 predicted 463
6 SASI_Hs01_00163971 predicted 405
7 SASI_Hs01_00163972 predicted 417
8 SASI_Hs01_00163973 predicted 342
9 SASI_Hs01_00163974 predicted 380
10 SASI_Hs01_00163975 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121406 predicted 588
2 SASI_Hs01_00121407 predicted 561
3 SASI_Hs01_00121408 predicted 538
4 SASI_Hs01_00121409 predicted 578
5 SASI_Hs01_00121410 predicted 574
6 SASI_Hs01_00121411 predicted 519
7 SASI_Hs01_00121412 predicted 533
8 SASI_Hs01_00121413 predicted 454
9 SASI_Hs01_00121414 predicted 493
10 SASI_Hs01_00121415 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213567 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033661 predicted 198
2 SASI_Rn01_00033663 predicted 217
3 SASI_Rn01_00033664 predicted 202
4 SASI_Rn01_00033665 predicted 198
5 SASI_Rn01_00033666 predicted 271
6 SASI_Rn01_00033667 predicted 269
7 SASI_Rn02_00270609 predicted 117
8 SASI_Rn01_00033668 predicted 354
9 SASI_Rn01_00033669 predicted 137
10 SASI_Rn01_00033670 predicted 318
11 SASI_Rn01_00033662 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326885 predicted 338
2 SASI_Mm01_00116243 predicted 450
3 SASI_Mm01_00116244 predicted 330
4 SASI_Mm01_00116245 predicted 363
5 SASI_Mm01_00116246 predicted 431
6 SASI_Mm02_00326886 predicted 347
7 SASI_Mm01_00116248 predicted 409
8 SASI_Mm01_00116249 predicted 403
9 SASI_Mm01_00116250 predicted 296
10 SASI_Mm01_00116251 predicted 417
11 SASI_Mm01_00116247 predicted 225
12 SASI_Mm01_00116252 predicted 245
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014596
ZNRD1 MISSION shRNA Bacterial Glycerol Stock
zinc ribbon domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014596.4-489s1c1
Sequence:CCGGCACCTGTACCAACTGCAAGTTCTCGAGAACTTGCAGTTGGTACAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014596.4-197s1c1
Sequence:CCGGACCTGGATTTCTGTTCAGATTCTCGAGAATCTGAACAGAAATCCAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014596.4-312s1c1
Sequence:CCGGTGTGAAGACTTCGGTTGTGTTCTCGAGAACACAACCGAAGTCTTCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014596.4-480s1c1
Sequence:CCGGTGTCTTCTACACCTGTACCAACTCGAGTTGGTACAGGTGTAGAAGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014596.4-271s1c1
Sequence:CCGGTGTGGCTTCAACATCAACGTTCTCGAGAACGTTGATGTTGAAGCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014596.4-451s21c1
Sequence:CCGGCAGATGCGTTCAGCCGATGAACTCGAGTTCATCGGCTGAACGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014596.4-409s21c1
Sequence:CCGGTGCCCTCGATGTGGTCATGAACTCGAGTTCATGACCACATCGAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014596.4-248s21c1
Sequence:CCGGAGGATACGGTCACCTGTATTCCTCGAGGAATACAGGTGACCGTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014596
ZNRD1 MISSION shRNA shRNA Plasmid DNA
zinc ribbon domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014596.4-489s1c1
Sequence:CCGGCACCTGTACCAACTGCAAGTTCTCGAGAACTTGCAGTTGGTACAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014596.4-197s1c1
Sequence:CCGGACCTGGATTTCTGTTCAGATTCTCGAGAATCTGAACAGAAATCCAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014596.4-312s1c1
Sequence:CCGGTGTGAAGACTTCGGTTGTGTTCTCGAGAACACAACCGAAGTCTTCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014596.4-480s1c1
Sequence:CCGGTGTCTTCTACACCTGTACCAACTCGAGTTGGTACAGGTGTAGAAGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014596.4-271s1c1
Sequence:CCGGTGTGGCTTCAACATCAACGTTCTCGAGAACGTTGATGTTGAAGCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014596.4-451s21c1
Sequence:CCGGCAGATGCGTTCAGCCGATGAACTCGAGTTCATCGGCTGAACGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014596.4-409s21c1
Sequence:CCGGTGCCCTCGATGTGGTCATGAACTCGAGTTCATGACCACATCGAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014596.4-248s21c1
Sequence:CCGGAGGATACGGTCACCTGTATTCCTCGAGGAATACAGGTGACCGTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014596
ZNRD1 MISSION shRNA Lentiviral Transduction Particles
zinc ribbon domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014596.4-489s1c1
Sequence:CCGGCACCTGTACCAACTGCAAGTTCTCGAGAACTTGCAGTTGGTACAGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014596.4-197s1c1
Sequence:CCGGACCTGGATTTCTGTTCAGATTCTCGAGAATCTGAACAGAAATCCAGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014596.4-312s1c1
Sequence:CCGGTGTGAAGACTTCGGTTGTGTTCTCGAGAACACAACCGAAGTCTTCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014596.4-480s1c1
Sequence:CCGGTGTCTTCTACACCTGTACCAACTCGAGTTGGTACAGGTGTAGAAGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014596.4-271s1c1
Sequence:CCGGTGTGGCTTCAACATCAACGTTCTCGAGAACGTTGATGTTGAAGCCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014596.4-451s21c1
Sequence:CCGGCAGATGCGTTCAGCCGATGAACTCGAGTTCATCGGCTGAACGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014596.4-409s21c1
Sequence:CCGGTGCCCTCGATGTGGTCATGAACTCGAGTTCATGACCACATCGAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014596.4-248s21c1
Sequence:CCGGAGGATACGGTCACCTGTATTCCTCGAGGAATACAGGTGACCGTATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023162
VALIDATED
ZNRD1 MISSION shRNA Bacterial Glycerol Stock
zinc ribbon domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023162.3-534s1c1
Sequence:CCGGCCCAGCAACAATCCTTTCCTTCTCGAGAAGGAAAGGATTGTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023162.3-301s1c1
Sequence:CCGGGAAGACCTCAGTAGTGTTCAACTCGAGTTGAACACTACTGAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023162.3-182s1c1
Sequence:CCGGGACTTGGATTTCTGCCCAGATCTCGAGATCTGGGCAGAAATCCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023162.3-274s1c1
Sequence:CCGGTGTGCGAGATTGTGAAGGGAACTCGAGTTCCCTTCACAATCTCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023162.3-463s1c1
Sequence:CCGGGACGGTCTTCTATACCTGTATCTCGAGATACAGGTATAGAAGACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023162.4-407s21c1
Sequence:CCGGGTCACGAGGGAATGGCATATCCTCGAGGATATGCCATTCCCTCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023162.4-349s21c1
Sequence:CCGGGTGGATGAGGGACCTGAATTACTCGAGTAATTCAGGTCCCTCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023162.4-462s21c1
Sequence:CCGGGACGGTCTTCTATACCTGTATCTCGAGATACAGGTATAGAAGACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023162.4-533s21c1
Sequence:CCGGCCCAGCAACAATCCTTTCCTTCTCGAGAAGGAAAGGATTGTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023162.4-300s21c1
Sequence:CCGGGAAGACCTCAGTAGTGTTCAACTCGAGTTGAACACTACTGAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023162
VALIDATED
ZNRD1 MISSION shRNA shRNA Plasmid DNA
zinc ribbon domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023162.3-534s1c1
Sequence:CCGGCCCAGCAACAATCCTTTCCTTCTCGAGAAGGAAAGGATTGTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023162.3-301s1c1
Sequence:CCGGGAAGACCTCAGTAGTGTTCAACTCGAGTTGAACACTACTGAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023162.3-182s1c1
Sequence:CCGGGACTTGGATTTCTGCCCAGATCTCGAGATCTGGGCAGAAATCCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023162.3-274s1c1
Sequence:CCGGTGTGCGAGATTGTGAAGGGAACTCGAGTTCCCTTCACAATCTCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023162.3-463s1c1
Sequence:CCGGGACGGTCTTCTATACCTGTATCTCGAGATACAGGTATAGAAGACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023162.4-407s21c1
Sequence:CCGGGTCACGAGGGAATGGCATATCCTCGAGGATATGCCATTCCCTCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023162.4-349s21c1
Sequence:CCGGGTGGATGAGGGACCTGAATTACTCGAGTAATTCAGGTCCCTCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023162.4-462s21c1
Sequence:CCGGGACGGTCTTCTATACCTGTATCTCGAGATACAGGTATAGAAGACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023162.4-533s21c1
Sequence:CCGGCCCAGCAACAATCCTTTCCTTCTCGAGAAGGAAAGGATTGTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023162.4-300s21c1
Sequence:CCGGGAAGACCTCAGTAGTGTTCAACTCGAGTTGAACACTACTGAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023162
VALIDATED
ZNRD1 MISSION shRNA Lentiviral Transduction Particles
zinc ribbon domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023162.3-534s1c1
Sequence:CCGGCCCAGCAACAATCCTTTCCTTCTCGAGAAGGAAAGGATTGTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023162.3-301s1c1
Sequence:CCGGGAAGACCTCAGTAGTGTTCAACTCGAGTTGAACACTACTGAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023162.3-182s1c1
Sequence:CCGGGACTTGGATTTCTGCCCAGATCTCGAGATCTGGGCAGAAATCCAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023162.3-274s1c1
Sequence:CCGGTGTGCGAGATTGTGAAGGGAACTCGAGTTCCCTTCACAATCTCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023162.3-463s1c1
Sequence:CCGGGACGGTCTTCTATACCTGTATCTCGAGATACAGGTATAGAAGACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023162.4-407s21c1
Sequence:CCGGGTCACGAGGGAATGGCATATCCTCGAGGATATGCCATTCCCTCGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023162.4-349s21c1
Sequence:CCGGGTGGATGAGGGACCTGAATTACTCGAGTAATTCAGGTCCCTCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023162.4-462s21c1
Sequence:CCGGGACGGTCTTCTATACCTGTATCTCGAGATACAGGTATAGAAGACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023162.4-533s21c1
Sequence:CCGGCCCAGCAACAATCCTTTCCTTCTCGAGAAGGAAAGGATTGTTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023162.4-300s21c1
Sequence:CCGGGAAGACCTCAGTAGTGTTCAACTCGAGTTGAACACTACTGAGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks