EMAIL THIS PAGE TO A FRIEND

ZNRF2

zinc and ring finger 2

Synonyms: RNF202
UniProtKB ID: Q8NHG8
Gene ID:
Mouse(387524) zinc and ring finger 2
Rat(362367) zinc and ring finger 2
chicken(420678) zinc and ring finger 2
domestic cat(101094746) zinc and ring finger 2
dog(611591) zinc and ring finger 2
cow(615645) zinc and ring finger 2
naked mole-rat(101726335) zinc and ring finger 2
domestic guinea pig(100722345) zinc and ring finger 2
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4500880 Anti-ZNRF2, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_147128 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_147128 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_147128 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199143 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199143 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199143 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_147128 Rosetta Predictions human pricing
NM_001108628 Rosetta Predictions rat pricing
NM_199143 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178432 predicted 1736
2 SASI_Hs01_00178433 predicted 1905
3 SASI_Hs01_00178425 predicted 1715
4 SASI_Hs02_00365470 predicted 1768
5 SASI_Hs01_00178426 predicted 1727
6 SASI_Hs01_00178427 predicted 1764
7 SASI_Hs01_00178428 predicted 1804
8 SASI_Hs02_00365471 predicted 1905
9 SASI_Hs01_00178429 predicted 1874
10 SASI_Hs01_00178431 predicted 1688
11 SASI_Hs01_00178430 predicted 1763
12 SASI_Hs01_00178434 predicted 2045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108628 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240499 predicted 492
2 SASI_Rn02_00240500 predicted 753
3 SASI_Rn02_00240501 predicted 692
4 SASI_Rn02_00240502 predicted 476
5 SASI_Rn02_00240503 predicted 567
6 SASI_Rn02_00240504 predicted 698
7 SASI_Rn02_00240505 predicted 616
8 SASI_Rn02_00240506 predicted 735
9 SASI_Rn02_00240507 predicted 524
10 SASI_Rn02_00240508 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134638 predicted 556
2 SASI_Mm01_00134639 predicted 644
3 SASI_Mm01_00134641 predicted 622
4 SASI_Mm01_00134642 predicted 592
5 SASI_Mm01_00134643 predicted 840
6 SASI_Mm01_00134644 predicted 606
7 SASI_Mm01_00134645 predicted 753
8 SASI_Mm01_00134646 predicted 863
9 SASI_Mm01_00134647 predicted 760
10 SASI_Mm02_00351355 predicted 915
11 SASI_Mm01_00134640 predicted 660
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_147128
VALIDATED
ZNRF2 MISSION shRNA Bacterial Glycerol Stock
zinc and ring finger 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147128.3-1574s21c1
Sequence:CCGGCATCTTGTAATGTGTTTAACACTCGAGTGTTAAACACATTACAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147128.3-1546s21c1
Sequence:CCGGATTTGTATCCTCAGATGAAATCTCGAGATTTCATCTGAGGATACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147128.3-2091s21c1
Sequence:CCGGGACGCCAAAGTTAACTGATTTCTCGAGAAATCAGTTAACTTTGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147128.3-1761s21c1
Sequence:CCGGCTGAGCACCCTTCAGATTAAGCTCGAGCTTAATCTGAAGGGTGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_147128.3-2042s1c1
Sequence:CCGGCCCTTAATAGTCATCTACATACTCGAGTATGTAGATGACTATTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_147128.3-1110s1c1
Sequence:CCGGGCTCGGATCTACCTTCCAGTACTCGAGTACTGGAAGGTAGATCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_147128.3-1616s1c1
Sequence:CCGGGAGGATGTACTGAGTAAAGATCTCGAGATCTTTACTCAGTACATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_147128.3-1505s1c1
Sequence:CCGGCCGCACATGTTTGGAGGATTTCTCGAGAAATCCTCCAAACATGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_147128.3-1597s1c1
Sequence:CCGGGCCACGAATAACCTATAATGACTCGAGTCATTATAGGTTATTCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_147128
VALIDATED
ZNRF2 MISSION shRNA shRNA Plasmid DNA
zinc and ring finger 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147128.3-1574s21c1
Sequence:CCGGCATCTTGTAATGTGTTTAACACTCGAGTGTTAAACACATTACAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147128.3-1546s21c1
Sequence:CCGGATTTGTATCCTCAGATGAAATCTCGAGATTTCATCTGAGGATACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147128.3-2091s21c1
Sequence:CCGGGACGCCAAAGTTAACTGATTTCTCGAGAAATCAGTTAACTTTGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147128.3-1761s21c1
Sequence:CCGGCTGAGCACCCTTCAGATTAAGCTCGAGCTTAATCTGAAGGGTGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_147128.3-2042s1c1
Sequence:CCGGCCCTTAATAGTCATCTACATACTCGAGTATGTAGATGACTATTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_147128.3-1110s1c1
Sequence:CCGGGCTCGGATCTACCTTCCAGTACTCGAGTACTGGAAGGTAGATCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_147128.3-1616s1c1
Sequence:CCGGGAGGATGTACTGAGTAAAGATCTCGAGATCTTTACTCAGTACATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_147128.3-1505s1c1
Sequence:CCGGCCGCACATGTTTGGAGGATTTCTCGAGAAATCCTCCAAACATGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_147128.3-1597s1c1
Sequence:CCGGGCCACGAATAACCTATAATGACTCGAGTCATTATAGGTTATTCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_147128
VALIDATED
ZNRF2 MISSION shRNA Lentiviral Transduction Particles
zinc and ring finger 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147128.3-1574s21c1
Sequence:CCGGCATCTTGTAATGTGTTTAACACTCGAGTGTTAAACACATTACAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147128.3-1546s21c1
Sequence:CCGGATTTGTATCCTCAGATGAAATCTCGAGATTTCATCTGAGGATACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_147128.3-2091s21c1
Sequence:CCGGGACGCCAAAGTTAACTGATTTCTCGAGAAATCAGTTAACTTTGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_147128.3-1761s21c1
Sequence:CCGGCTGAGCACCCTTCAGATTAAGCTCGAGCTTAATCTGAAGGGTGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_147128.3-2042s1c1
Sequence:CCGGCCCTTAATAGTCATCTACATACTCGAGTATGTAGATGACTATTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_147128.3-1110s1c1
Sequence:CCGGGCTCGGATCTACCTTCCAGTACTCGAGTACTGGAAGGTAGATCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_147128.3-1616s1c1
Sequence:CCGGGAGGATGTACTGAGTAAAGATCTCGAGATCTTTACTCAGTACATCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_147128.3-1505s1c1
Sequence:CCGGCCGCACATGTTTGGAGGATTTCTCGAGAAATCCTCCAAACATGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_147128.3-1597s1c1
Sequence:CCGGGCCACGAATAACCTATAATGACTCGAGTCATTATAGGTTATTCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199143
VALIDATED
ZNRF2 MISSION shRNA Bacterial Glycerol Stock
zinc and ring finger 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199143.1-622s21c1
Sequence:CCGGGTGTTTAACAAAGCCAAGAATCTCGAGATTCTTGGCTTTGTTAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199143.1-596s21c1
Sequence:CCGGGATGAAATGGATTTGCATCTTCTCGAGAAGATGCAAATCCATTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199143.1-737s21c1
Sequence:CCGGTGCCTGTGTATATATCATAAACTCGAGTTTATGATATATACACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199143.1-1060s21c1
Sequence:CCGGGCGTAGATGACACTGATAAATCTCGAGATTTATCAGTGTCATCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199143.1-622s1c1
Sequence:CCGGGTGTTTAACAAAGCCAAGAATCTCGAGATTCTTGGCTTTGTTAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199143.1-766s1c1
Sequence:CCGGAGATGAATGGTTTGAAGTCAACTCGAGTTGACTTCAAACCATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199143.1-596s1c1
Sequence:CCGGGATGAAATGGATTTGCATCTTCTCGAGAAGATGCAAATCCATTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199143.1-542s1c1
Sequence:CCGGCCGCACTTGTTTGGAGGATTTCTCGAGAAATCCTCCAAACAAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199143.1-680s1c1
Sequence:CCGGGAATGTGCAATATGCCTTGAACTCGAGTTCAAGGCATATTGCACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199143
VALIDATED
ZNRF2 MISSION shRNA shRNA Plasmid DNA
zinc and ring finger 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199143.1-622s21c1
Sequence:CCGGGTGTTTAACAAAGCCAAGAATCTCGAGATTCTTGGCTTTGTTAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199143.1-596s21c1
Sequence:CCGGGATGAAATGGATTTGCATCTTCTCGAGAAGATGCAAATCCATTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199143.1-737s21c1
Sequence:CCGGTGCCTGTGTATATATCATAAACTCGAGTTTATGATATATACACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199143.1-1060s21c1
Sequence:CCGGGCGTAGATGACACTGATAAATCTCGAGATTTATCAGTGTCATCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199143.1-622s1c1
Sequence:CCGGGTGTTTAACAAAGCCAAGAATCTCGAGATTCTTGGCTTTGTTAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199143.1-766s1c1
Sequence:CCGGAGATGAATGGTTTGAAGTCAACTCGAGTTGACTTCAAACCATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199143.1-596s1c1
Sequence:CCGGGATGAAATGGATTTGCATCTTCTCGAGAAGATGCAAATCCATTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199143.1-542s1c1
Sequence:CCGGCCGCACTTGTTTGGAGGATTTCTCGAGAAATCCTCCAAACAAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199143.1-680s1c1
Sequence:CCGGGAATGTGCAATATGCCTTGAACTCGAGTTCAAGGCATATTGCACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199143
VALIDATED
ZNRF2 MISSION shRNA Lentiviral Transduction Particles
zinc and ring finger 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199143.1-622s21c1
Sequence:CCGGGTGTTTAACAAAGCCAAGAATCTCGAGATTCTTGGCTTTGTTAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199143.1-596s21c1
Sequence:CCGGGATGAAATGGATTTGCATCTTCTCGAGAAGATGCAAATCCATTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199143.1-737s21c1
Sequence:CCGGTGCCTGTGTATATATCATAAACTCGAGTTTATGATATATACACAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_199143.1-1060s21c1
Sequence:CCGGGCGTAGATGACACTGATAAATCTCGAGATTTATCAGTGTCATCTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199143.1-622s1c1
Sequence:CCGGGTGTTTAACAAAGCCAAGAATCTCGAGATTCTTGGCTTTGTTAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199143.1-766s1c1
Sequence:CCGGAGATGAATGGTTTGAAGTCAACTCGAGTTGACTTCAAACCATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199143.1-596s1c1
Sequence:CCGGGATGAAATGGATTTGCATCTTCTCGAGAAGATGCAAATCCATTTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199143.1-542s1c1
Sequence:CCGGCCGCACTTGTTTGGAGGATTTCTCGAGAAATCCTCCAAACAAGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_199143.1-680s1c1
Sequence:CCGGGAATGTGCAATATGCCTTGAACTCGAGTTCAAGGCATATTGCACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks