EMAIL THIS PAGE TO A FRIEND

ZNRF3

zinc and ring finger 3

Synonyms: BK747E2.3 RNF203
UniProtKB ID: Q9ULT6, B3KU18, Q6ICH1, Q6NTF8, Q8WU18
Gene ID:
Mouse(407821) zinc and ring finger 3
Rat(685487) zinc and ring finger 3
Zebrafish(556813) zinc and ring finger 3
chicken(416919) zinc and ring finger 3
dog(486339) zinc and ring finger 3
Horse(100059173) zinc and ring finger 3
domestic cat(101086348) zinc and ring finger 3
domestic guinea pig(100727159) zinc and ring finger 3
naked mole-rat(101723789) zinc and ring finger 3
Domestic Rabbit(100340444) zinc and ring finger 3
cow(535441) zinc and ring finger 3
sheep(101119937) zinc and ring finger 3
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080924 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080924 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080924 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032173 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032173 Rosetta Predictions human pricing
XM_290972 Rosetta Predictions human pricing
XM_933884 Rosetta Predictions human pricing
XM_933888 Rosetta Predictions human pricing
NM_001080924 Rosetta Predictions mouse pricing
XM_893176 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359435 predicted 313
2 SASI_Hs02_00359436 predicted 2246
3 SASI_Hs02_00359437 predicted 485
4 SASI_Hs02_00359438 predicted 417
5 SASI_Hs02_00359439 predicted 247
6 SASI_Hs02_00359440 predicted 252
7 SASI_Hs02_00359441 predicted 385
8 SASI_Hs02_00359442 predicted 313
9 SASI_Hs02_00359443 predicted 448
10 SASI_Hs02_00359444 predicted 2359
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_290972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266708 predicted 487
2 SASI_Hs01_00266709 predicted 1754
3 SASI_Hs01_00266710 predicted 513
4 SASI_Hs01_00266711 predicted 2102
5 SASI_Hs01_00266712 predicted 352
6 SASI_Hs01_00266713 predicted 276
7 SASI_Hs01_00266714 predicted 240
8 SASI_Hs01_00266715 predicted 501
9 SASI_Hs01_00266716 predicted 307
10 SASI_Hs01_00266717 predicted 2218
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288193 predicted 551
2 SASI_Hs01_00288194 predicted 1973
3 SASI_Hs01_00288195 predicted 1777
4 SASI_Hs01_00288196 predicted 1530
5 SASI_Hs01_00288197 predicted 2183
6 SASI_Hs01_00288198 predicted 1649
7 SASI_Hs01_00288199 predicted 837
8 SASI_Hs01_00288200 predicted 2455
9 SASI_Hs01_00288201 predicted 1921
10 SASI_Hs01_00288202 predicted 1863
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267149 predicted 1813
2 SASI_Hs01_00267150 predicted 246
3 SASI_Hs01_00267151 predicted 580
4 SASI_Hs01_00267152 predicted 2179
5 SASI_Hs01_00267153 predicted 412
6 SASI_Hs01_00267154 predicted 341
7 SASI_Hs01_00267155 predicted 310
8 SASI_Hs01_00267156 predicted 240
9 SASI_Hs01_00267157 predicted 377
10 SASI_Hs01_00267158 predicted 2281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080924 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293943 predicted 2373
2 SASI_Mm02_00293944 predicted 2504
3 SASI_Mm02_00293945 predicted 680
4 SASI_Mm02_00293946 predicted 794
5 SASI_Mm02_00293947 predicted 1550
6 SASI_Mm02_00293948 predicted 2594
7 SASI_Mm02_00293949 predicted 1607
8 SASI_Mm02_00293950 predicted 1248
9 SASI_Mm02_00293951 predicted 607
10 SASI_Mm02_00293952 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_893176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204656 predicted 575
2 SASI_Mm01_00204657 predicted 2362
3 SASI_Mm01_00204658 predicted 2723
4 SASI_Mm01_00204659 predicted 652
5 SASI_Mm01_00204660 predicted 1411
6 SASI_Mm01_00204661 predicted 2447
7 SASI_Mm01_00204662 predicted 1097
8 SASI_Mm01_00204663 predicted 576
9 SASI_Mm01_00204664 predicted 1254
10 SASI_Mm01_00204665 predicted 1228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080924
VALIDATED
ZNRF3 MISSION shRNA Bacterial Glycerol Stock
zinc and ring finger 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080924.2-2391s21c1
Sequence:CCGGGTCTTCACTCAGACCATTATCCTCGAGGATAATGGTCTGAGTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080924.2-4738s21c1
Sequence:CCGGCGTCAGATGGCCCAGTTATTTCTCGAGAAATAACTGGGCCATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080924.2-792s21c1
Sequence:CCGGGACAACCCACCGAGTACTTTGCTCGAGCAAAGTACTCGGTGGGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080924.2-1243s21c1
Sequence:CCGGAGTGACCCTACCGGTACATTACTCGAGTAATGTACCGGTAGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080924.2-2500s21c1
Sequence:CCGGCTGCTACACTGAGGACTATTCCTCGAGGAATAGTCCTCAGTGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080924
VALIDATED
ZNRF3 MISSION shRNA shRNA Plasmid DNA
zinc and ring finger 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080924.2-2391s21c1
Sequence:CCGGGTCTTCACTCAGACCATTATCCTCGAGGATAATGGTCTGAGTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080924.2-4738s21c1
Sequence:CCGGCGTCAGATGGCCCAGTTATTTCTCGAGAAATAACTGGGCCATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080924.2-792s21c1
Sequence:CCGGGACAACCCACCGAGTACTTTGCTCGAGCAAAGTACTCGGTGGGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080924.2-1243s21c1
Sequence:CCGGAGTGACCCTACCGGTACATTACTCGAGTAATGTACCGGTAGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080924.2-2500s21c1
Sequence:CCGGCTGCTACACTGAGGACTATTCCTCGAGGAATAGTCCTCAGTGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080924
VALIDATED
ZNRF3 MISSION shRNA Lentiviral Transduction Particles
zinc and ring finger 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080924.2-2391s21c1
Sequence:CCGGGTCTTCACTCAGACCATTATCCTCGAGGATAATGGTCTGAGTGAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080924.2-4738s21c1
Sequence:CCGGCGTCAGATGGCCCAGTTATTTCTCGAGAAATAACTGGGCCATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080924.2-792s21c1
Sequence:CCGGGACAACCCACCGAGTACTTTGCTCGAGCAAAGTACTCGGTGGGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001080924.2-1243s21c1
Sequence:CCGGAGTGACCCTACCGGTACATTACTCGAGTAATGTACCGGTAGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080924.2-2500s21c1
Sequence:CCGGCTGCTACACTGAGGACTATTCCTCGAGGAATAGTCCTCAGTGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032173
VALIDATED
ZNRF3 MISSION shRNA Bacterial Glycerol Stock
zinc and ring finger 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_032173.2-492s21c1
Sequence:CCGGTCCTCGACAACCCACTGAATACTCGAGTATTCAGTGGGTTGTCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032173.2-3994s21c1
Sequence:CCGGGTCTACCTAATGCACTATTATCTCGAGATAATAGTGCATTAGGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_032173.2-194s21c1
Sequence:CCGGATGACGAAGAGGACTTGTATGCTCGAGCATACAAGTCCTCTTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032173.2-860s21c1
Sequence:CCGGACTGTCGGCACAACATCATAGCTCGAGCTATGATGTTGTGCCGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032173.2-414s21c1
Sequence:CCGGGAAGGGTGCAGATGCCATTAACTCGAGTTAATGGCATCTGCACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032173
VALIDATED
ZNRF3 MISSION shRNA shRNA Plasmid DNA
zinc and ring finger 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_032173.2-492s21c1
Sequence:CCGGTCCTCGACAACCCACTGAATACTCGAGTATTCAGTGGGTTGTCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032173.2-3994s21c1
Sequence:CCGGGTCTACCTAATGCACTATTATCTCGAGATAATAGTGCATTAGGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_032173.2-194s21c1
Sequence:CCGGATGACGAAGAGGACTTGTATGCTCGAGCATACAAGTCCTCTTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032173.2-860s21c1
Sequence:CCGGACTGTCGGCACAACATCATAGCTCGAGCTATGATGTTGTGCCGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032173.2-414s21c1
Sequence:CCGGGAAGGGTGCAGATGCCATTAACTCGAGTTAATGGCATCTGCACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032173
VALIDATED
ZNRF3 MISSION shRNA Lentiviral Transduction Particles
zinc and ring finger 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_032173.2-492s21c1
Sequence:CCGGTCCTCGACAACCCACTGAATACTCGAGTATTCAGTGGGTTGTCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253789    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032173.2-3994s21c1
Sequence:CCGGGTCTACCTAATGCACTATTATCTCGAGATAATAGTGCATTAGGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_032173.2-194s21c1
Sequence:CCGGATGACGAAGAGGACTTGTATGCTCGAGCATACAAGTCCTCTTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032173.2-860s21c1
Sequence:CCGGACTGTCGGCACAACATCATAGCTCGAGCTATGATGTTGTGCCGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032173.2-414s21c1
Sequence:CCGGGAAGGGTGCAGATGCCATTAACTCGAGTTAATGGCATCTGCACCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks