EMAIL THIS PAGE TO A FRIEND

ZNRF4

zinc and ring finger 4

Synonyms: RNF204 SPERIZIN Ssrzf1 spzn
UniProtKB ID: Q8WWF5, A8K886, O75866
Gene ID:
Mouse(20834) zinc and ring finger 4
Rat(301127) zinc and ring finger 4
chicken(420152) zinc and ring finger 4
dog(485029) zinc and ring finger 4
cow(517394) zinc and ring finger 4
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011483 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011483 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011483 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181710 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181710 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181710 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121121 MISSION® esiRNA esiRNA human ZNRF4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181710 Rosetta Predictions human pricing
NM_001024878 Rosetta Predictions rat pricing
NM_011483 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158764 predicted 859
2 SASI_Hs02_00370315 predicted 207
3 SASI_Hs01_00158766 predicted 569
4 SASI_Hs01_00158767 predicted 316
5 SASI_Hs01_00158768 predicted 655
6 SASI_Hs01_00158769 predicted 267
7 SASI_Hs01_00158770 predicted 248
8 SASI_Hs01_00158771 predicted 328
9 SASI_Hs01_00158772 predicted 929
10 SASI_Hs01_00158773 predicted 460
11 SASI_Hs01_00158765 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024878 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117598 predicted 719
2 SASI_Rn01_00117599 predicted 783
3 SASI_Rn01_00117600 predicted 808
4 SASI_Rn01_00117601 predicted 721
5 SASI_Rn01_00117602 predicted 860
6 SASI_Rn01_00117603 predicted 623
7 SASI_Rn01_00117604 predicted 475
8 SASI_Rn01_00117605 predicted 476
9 SASI_Rn01_00117606 predicted 921
10 SASI_Rn02_00202761 predicted 438
11 SASI_Rn01_00117607 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011483 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155806 predicted 673
2 SASI_Mm01_00155807 predicted 972
3 SASI_Mm01_00155809 predicted 399
4 SASI_Mm01_00155810 predicted 665
5 SASI_Mm01_00155811 predicted 535
6 SASI_Mm01_00155812 predicted 771
7 SASI_Mm02_00320761 predicted 397
8 SASI_Mm01_00155813 predicted 611
9 SASI_Mm01_00155814 predicted 616
10 SASI_Mm02_00320762 predicted 216
11 SASI_Mm01_00155808 predicted 823
12 SASI_Mm01_00155815 predicted 677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011483
ZNRF4 MISSION shRNA Bacterial Glycerol Stock
zinc and ring finger 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011483.2-405s21c1
Sequence:CCGGACCACTCACTGGACCCACTAGCTCGAGCTAGTGGGTCCAGTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011483.2-534s21c1
Sequence:CCGGAGTTTGAGGACTTGGAGGTGACTCGAGTCACCTCCAAGTCCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011483.2-222s21c1
Sequence:CCGGTGACTTTCTGGCTGGTCCTGTCTCGAGACAGGACCAGCCAGAAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011483.2-846s21c1
Sequence:CCGGAGATCCTGCCTTGCGCACATGCTCGAGCATGTGCGCAAGGCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011483.1-194s1c1
Sequence:CCGGGCTCAGGTTAACTTGAGCTCTCTCGAGAGAGCTCAAGTTAACCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011483.1-672s1c1
Sequence:CCGGCCGCGGTGAAGACGCAGACATCTCGAGATGTCTGCGTCTTCACCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011483.1-555s1c1
Sequence:CCGGGTCACCCTGTAGTGGTTGCATCTCGAGATGCAACCACTACAGGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011483.1-601s1c1
Sequence:CCGGCCTGGCCGCATCTACGCTGTTCTCGAGAACAGCGTAGATGCGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011483.1-861s1c1
Sequence:CCGGGCAAACAGTCAGTGGCCAGCACTCGAGTGCTGGCCACTGACTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011483
ZNRF4 MISSION shRNA shRNA Plasmid DNA
zinc and ring finger 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011483.2-405s21c1
Sequence:CCGGACCACTCACTGGACCCACTAGCTCGAGCTAGTGGGTCCAGTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011483.2-534s21c1
Sequence:CCGGAGTTTGAGGACTTGGAGGTGACTCGAGTCACCTCCAAGTCCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011483.2-222s21c1
Sequence:CCGGTGACTTTCTGGCTGGTCCTGTCTCGAGACAGGACCAGCCAGAAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011483.2-846s21c1
Sequence:CCGGAGATCCTGCCTTGCGCACATGCTCGAGCATGTGCGCAAGGCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011483.1-194s1c1
Sequence:CCGGGCTCAGGTTAACTTGAGCTCTCTCGAGAGAGCTCAAGTTAACCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011483.1-672s1c1
Sequence:CCGGCCGCGGTGAAGACGCAGACATCTCGAGATGTCTGCGTCTTCACCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011483.1-555s1c1
Sequence:CCGGGTCACCCTGTAGTGGTTGCATCTCGAGATGCAACCACTACAGGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011483.1-601s1c1
Sequence:CCGGCCTGGCCGCATCTACGCTGTTCTCGAGAACAGCGTAGATGCGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011483.1-861s1c1
Sequence:CCGGGCAAACAGTCAGTGGCCAGCACTCGAGTGCTGGCCACTGACTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011483
ZNRF4 MISSION shRNA Lentiviral Transduction Particles
zinc and ring finger 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011483.2-405s21c1
Sequence:CCGGACCACTCACTGGACCCACTAGCTCGAGCTAGTGGGTCCAGTGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011483.2-534s21c1
Sequence:CCGGAGTTTGAGGACTTGGAGGTGACTCGAGTCACCTCCAAGTCCTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011483.2-222s21c1
Sequence:CCGGTGACTTTCTGGCTGGTCCTGTCTCGAGACAGGACCAGCCAGAAAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011483.2-846s21c1
Sequence:CCGGAGATCCTGCCTTGCGCACATGCTCGAGCATGTGCGCAAGGCAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011483.1-194s1c1
Sequence:CCGGGCTCAGGTTAACTTGAGCTCTCTCGAGAGAGCTCAAGTTAACCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011483.1-672s1c1
Sequence:CCGGCCGCGGTGAAGACGCAGACATCTCGAGATGTCTGCGTCTTCACCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011483.1-555s1c1
Sequence:CCGGGTCACCCTGTAGTGGTTGCATCTCGAGATGCAACCACTACAGGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011483.1-601s1c1
Sequence:CCGGCCTGGCCGCATCTACGCTGTTCTCGAGAACAGCGTAGATGCGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011483.1-861s1c1
Sequence:CCGGGCAAACAGTCAGTGGCCAGCACTCGAGTGCTGGCCACTGACTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181710
ZNRF4 MISSION shRNA Bacterial Glycerol Stock
zinc and ring finger 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181710.2-1127s1c1
Sequence:CCGGGCCGCCACAGAAGACAGCTTTCTCGAGAAAGCTGTCTTCTGTGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181710.2-640s1c1
Sequence:CCGGCGTGAGCATGACCCACGTCTACTCGAGTAGACGTGGGTCATGCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181710.2-851s1c1
Sequence:CCGGCTGGTCGTATCAGCCTTCTTTCTCGAGAAAGAAGGCTGATACGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181710.2-137s1c1
Sequence:CCGGCACGCGGTCATTCCAACTCAACTCGAGTTGAGTTGGAATGACCGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181710.2-1290s1c1
Sequence:CCGGCGTCCCTGGAGGCAGAGTATACTCGAGTATACTCTGCCTCCAGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181710
ZNRF4 MISSION shRNA shRNA Plasmid DNA
zinc and ring finger 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181710.2-1127s1c1
Sequence:CCGGGCCGCCACAGAAGACAGCTTTCTCGAGAAAGCTGTCTTCTGTGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181710.2-640s1c1
Sequence:CCGGCGTGAGCATGACCCACGTCTACTCGAGTAGACGTGGGTCATGCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181710.2-851s1c1
Sequence:CCGGCTGGTCGTATCAGCCTTCTTTCTCGAGAAAGAAGGCTGATACGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181710.2-137s1c1
Sequence:CCGGCACGCGGTCATTCCAACTCAACTCGAGTTGAGTTGGAATGACCGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181710.2-1290s1c1
Sequence:CCGGCGTCCCTGGAGGCAGAGTATACTCGAGTATACTCTGCCTCCAGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181710
ZNRF4 MISSION shRNA Lentiviral Transduction Particles
zinc and ring finger 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181710.2-1127s1c1
Sequence:CCGGGCCGCCACAGAAGACAGCTTTCTCGAGAAAGCTGTCTTCTGTGGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181710.2-640s1c1
Sequence:CCGGCGTGAGCATGACCCACGTCTACTCGAGTAGACGTGGGTCATGCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181710.2-851s1c1
Sequence:CCGGCTGGTCGTATCAGCCTTCTTTCTCGAGAAAGAAGGCTGATACGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181710.2-137s1c1
Sequence:CCGGCACGCGGTCATTCCAACTCAACTCGAGTTGAGTTGGAATGACCGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181710.2-1290s1c1
Sequence:CCGGCGTCCCTGGAGGCAGAGTATACTCGAGTATACTCTGCCTCCAGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks