EMAIL THIS PAGE TO A FRIEND

ZP1

zona pellucida glycoprotein 1 (sperm receptor)

UniProtKB ID: P60852
Gene ID:
Mouse(22786) zona pellucida glycoprotein 1
Rat(85271) zona pellucida glycoprotein 1 (sperm receptor)
chicken(395418) zona pellucida glycoprotein 1 (sperm receptor)
dog(100688717) zona pellucida glycoprotein 1 (sperm receptor)
domestic cat(101082009) zona pellucida glycoprotein 1 (sperm receptor)
Horse(100061971) zona pellucida glycoprotein 1 (sperm receptor)
Domestic Rabbit(100354409) zona pellucida glycoprotein 1 (sperm receptor)
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207341 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009580 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009580 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009580 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110311 MISSION® esiRNA esiRNA human ZP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207341 Rosetta Predictions human pricing
XM_001074922 Rosetta Predictions rat pricing
XM_001075428 Rosetta Predictions rat pricing
NM_009580 Rosetta Predictions mouse pricing
XM_986504 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120482 predicted 403
2 SASI_Hs01_00120483 predicted 1643
3 SASI_Hs01_00120484 predicted 213
4 SASI_Hs01_00120485 predicted 869
5 SASI_Hs01_00120486 predicted 1448
6 SASI_Hs01_00120487 predicted 977
7 SASI_Hs01_00120488 predicted 1160
8 SASI_Hs01_00120489 predicted 287
9 SASI_Hs01_00120490 predicted 887
10 SASI_Hs01_00120491 predicted 1471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074922 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347742 predicted 285
2 SASI_Rn02_00347743 predicted 1002
3 SASI_Rn02_00347744 predicted 1637
4 SASI_Rn02_00347745 predicted 1428
5 SASI_Rn02_00347746 predicted 660
6 SASI_Rn02_00347747 predicted 1019
7 SASI_Rn02_00347748 predicted 227
8 SASI_Rn02_00347749 predicted 1413
9 SASI_Rn02_00347750 predicted 1465
10 SASI_Rn02_00347751 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075428 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349683 predicted 1003
2 SASI_Rn02_00349684 predicted 1445
3 SASI_Rn02_00349685 predicted 1632
4 SASI_Rn02_00349686 predicted 339
5 SASI_Rn02_00349687 predicted 1430
6 SASI_Rn02_00349688 predicted 1017
7 SASI_Rn02_00349689 predicted 225
8 SASI_Rn02_00349690 predicted 1411
9 SASI_Rn02_00349691 predicted 387
10 SASI_Rn02_00349692 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316474 predicted 777
2 SASI_Mm02_00316475 predicted 278
3 SASI_Mm02_00316476 predicted 1413
4 SASI_Mm02_00316477 predicted 221
5 SASI_Mm02_00316478 predicted 1112
6 SASI_Mm02_00316479 predicted 1459
7 SASI_Mm02_00316480 predicted 1567
8 SASI_Mm02_00316481 predicted 844
9 SASI_Mm02_00316482 predicted 999
10 SASI_Mm02_00316483 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_986504 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219964 predicted 570
2 SASI_Mm01_00219965 predicted 1059
3 SASI_Mm01_00219966 predicted 354
4 SASI_Mm01_00219967 predicted 390
5 SASI_Mm01_00219968 predicted 363
6 SASI_Mm01_00219969 predicted 1131
7 SASI_Mm01_00219970 predicted 1151
8 SASI_Mm01_00219971 predicted 1039
9 SASI_Mm01_00219972 predicted 425
10 SASI_Mm01_00219973 predicted 414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207341
ZP1 MISSION shRNA Bacterial Glycerol Stock
zona pellucida glycoprotein 1 (sperm receptor)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207341.2-227s1c1
Sequence:CCGGGAACCGATTTGATGTCAACAACTCGAGTTGTTGACATCAAATCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207341.2-1529s1c1
Sequence:CCGGGCGATTCACTGTTGCTACCTTCTCGAGAAGGTAGCAACAGTGAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207341.2-411s1c1
Sequence:CCGGGCTACTCTGATCTGTCCCAAACTCGAGTTTGGGACAGATCAGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207341.2-754s1c1
Sequence:CCGGGCATCGTGAGAAGAACTTCAACTCGAGTTGAAGTTCTTCTCACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-1049s1c1
Sequence:CCGGGCTCATCTATGAGAACTGGCTCTCGAGAGCCAGTTCTCATAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-1250s1c1
Sequence:CCGGGATTGCCAAAGACGAGACCTTCTCGAGAAGGTCTCGTCTTTGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207341.2-881s1c1
Sequence:CCGGCCTCGTAGTGTCCCAAGAAATCTCGAGATTTCTTGGGACACTACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-825s1c1
Sequence:CCGGCCCTGTTACTATGGCAACACACTCGAGTGTGTTGCCATAGTAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-1475s1c1
Sequence:CCGGCAGAACCCAAATGGTAGCCTTCTCGAGAAGGCTACCATTTGGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-1580s1c1
Sequence:CCGGCCTCAGAGGACTGGTTTACTTCTCGAGAAGTAAACCAGTCCTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-242s1c1
Sequence:CCGGCAACAACTGCTCCATCTGCTACTCGAGTAGCAGATGGAGCAGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-857s1c1
Sequence:CCGGGTGCTTCAGAGATGGCTACTTCTCGAGAAGTAGCCATCTCTGAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207341
ZP1 MISSION shRNA shRNA Plasmid DNA
zona pellucida glycoprotein 1 (sperm receptor)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207341.2-227s1c1
Sequence:CCGGGAACCGATTTGATGTCAACAACTCGAGTTGTTGACATCAAATCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207341.2-1529s1c1
Sequence:CCGGGCGATTCACTGTTGCTACCTTCTCGAGAAGGTAGCAACAGTGAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207341.2-411s1c1
Sequence:CCGGGCTACTCTGATCTGTCCCAAACTCGAGTTTGGGACAGATCAGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207341.2-754s1c1
Sequence:CCGGGCATCGTGAGAAGAACTTCAACTCGAGTTGAAGTTCTTCTCACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-1049s1c1
Sequence:CCGGGCTCATCTATGAGAACTGGCTCTCGAGAGCCAGTTCTCATAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-1250s1c1
Sequence:CCGGGATTGCCAAAGACGAGACCTTCTCGAGAAGGTCTCGTCTTTGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207341.2-881s1c1
Sequence:CCGGCCTCGTAGTGTCCCAAGAAATCTCGAGATTTCTTGGGACACTACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-825s1c1
Sequence:CCGGCCCTGTTACTATGGCAACACACTCGAGTGTGTTGCCATAGTAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-1475s1c1
Sequence:CCGGCAGAACCCAAATGGTAGCCTTCTCGAGAAGGCTACCATTTGGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-1580s1c1
Sequence:CCGGCCTCAGAGGACTGGTTTACTTCTCGAGAAGTAAACCAGTCCTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-242s1c1
Sequence:CCGGCAACAACTGCTCCATCTGCTACTCGAGTAGCAGATGGAGCAGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-857s1c1
Sequence:CCGGGTGCTTCAGAGATGGCTACTTCTCGAGAAGTAGCCATCTCTGAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207341
ZP1 MISSION shRNA Lentiviral Transduction Particles
zona pellucida glycoprotein 1 (sperm receptor)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207341.2-227s1c1
Sequence:CCGGGAACCGATTTGATGTCAACAACTCGAGTTGTTGACATCAAATCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207341.2-1529s1c1
Sequence:CCGGGCGATTCACTGTTGCTACCTTCTCGAGAAGGTAGCAACAGTGAATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207341.2-411s1c1
Sequence:CCGGGCTACTCTGATCTGTCCCAAACTCGAGTTTGGGACAGATCAGAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207341.2-754s1c1
Sequence:CCGGGCATCGTGAGAAGAACTTCAACTCGAGTTGAAGTTCTTCTCACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-1049s1c1
Sequence:CCGGGCTCATCTATGAGAACTGGCTCTCGAGAGCCAGTTCTCATAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-1250s1c1
Sequence:CCGGGATTGCCAAAGACGAGACCTTCTCGAGAAGGTCTCGTCTTTGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207341.2-881s1c1
Sequence:CCGGCCTCGTAGTGTCCCAAGAAATCTCGAGATTTCTTGGGACACTACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-825s1c1
Sequence:CCGGCCCTGTTACTATGGCAACACACTCGAGTGTGTTGCCATAGTAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-1475s1c1
Sequence:CCGGCAGAACCCAAATGGTAGCCTTCTCGAGAAGGCTACCATTTGGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-1580s1c1
Sequence:CCGGCCTCAGAGGACTGGTTTACTTCTCGAGAAGTAAACCAGTCCTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-242s1c1
Sequence:CCGGCAACAACTGCTCCATCTGCTACTCGAGTAGCAGATGGAGCAGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207341.2-857s1c1
Sequence:CCGGGTGCTTCAGAGATGGCTACTTCTCGAGAAGTAGCCATCTCTGAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009580
ZP1 MISSION shRNA Bacterial Glycerol Stock
zona pellucida glycoprotein 1 (sperm receptor)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009580.1-136s1c1
Sequence:CCGGCCTGGCTTTGAATACAGCTATCTCGAGATAGCTGTATTCAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009580.1-1056s1c1
Sequence:CCGGCGAACAACTCATCTATGAGAACTCGAGTTCTCATAGATGAGTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009580.1-1160s1c1
Sequence:CCGGGCATCTTCAATGCTAGCGATTCTCGAGAATCGCTAGCATTGAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009580.1-768s1c1
Sequence:CCGGCATGGTAAATGGAAGTTCCAACTCGAGTTGGAACTTCCATTTACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009580.1-403s1c1
Sequence:CCGGCGTGTGGATATAGCACAAGATCTCGAGATCTTGTGCTATATCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009580
ZP1 MISSION shRNA shRNA Plasmid DNA
zona pellucida glycoprotein 1 (sperm receptor)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009580.1-136s1c1
Sequence:CCGGCCTGGCTTTGAATACAGCTATCTCGAGATAGCTGTATTCAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009580.1-1056s1c1
Sequence:CCGGCGAACAACTCATCTATGAGAACTCGAGTTCTCATAGATGAGTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009580.1-1160s1c1
Sequence:CCGGGCATCTTCAATGCTAGCGATTCTCGAGAATCGCTAGCATTGAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009580.1-768s1c1
Sequence:CCGGCATGGTAAATGGAAGTTCCAACTCGAGTTGGAACTTCCATTTACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009580.1-403s1c1
Sequence:CCGGCGTGTGGATATAGCACAAGATCTCGAGATCTTGTGCTATATCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009580
ZP1 MISSION shRNA Lentiviral Transduction Particles
zona pellucida glycoprotein 1 (sperm receptor)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009580.1-136s1c1
Sequence:CCGGCCTGGCTTTGAATACAGCTATCTCGAGATAGCTGTATTCAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009580.1-1056s1c1
Sequence:CCGGCGAACAACTCATCTATGAGAACTCGAGTTCTCATAGATGAGTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009580.1-1160s1c1
Sequence:CCGGGCATCTTCAATGCTAGCGATTCTCGAGAATCGCTAGCATTGAAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009580.1-768s1c1
Sequence:CCGGCATGGTAAATGGAAGTTCCAACTCGAGTTGGAACTTCCATTTACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009580.1-403s1c1
Sequence:CCGGCGTGTGGATATAGCACAAGATCTCGAGATCTTGTGCTATATCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks