EMAIL THIS PAGE TO A FRIEND

ZP2

zona pellucida glycoprotein 2 (sperm receptor)

Synonyms: ZPA Zp-2
UniProtKB ID: Q05996, B2R7J2, Q4VAN9, Q4VAP0
Gene ID:
Human(7783) Summary: The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The protein encoded by this gene is a structural component of the zona pellucida and functions in secondary binding and penetration of acrosome-reacted spermatozoa. The nascent protein contains a N-terminal signal peptide sequence, a conserved ZP domain, a consensus furin cleavage site, and a C-terminal transmembrane domain. It is hypothesized that furin cleavage results in release of the mature protein from the plasma membrane for subsequent incorporation into the zona pellucida matrix. However, the requirement for furin cleavage in this process remains controversial based on mouse studies. [provided by RefSeq, Jul 2008]
Mouse(22787) zona pellucida glycoprotein 2
Rat(81828) zona pellucida glycoprotein 2 (sperm receptor)
Domestic Rabbit(100009069) zona pellucida glycoprotein 2 (sperm receptor)
naked mole-rat(101706160) zona pellucida glycoprotein 2 (sperm receptor)
domestic guinea pig(100713508) zona pellucida glycoprotein 2 (sperm receptor)
cow(280963) zona pellucida glycoprotein 2 (sperm receptor)
sheep(101123598) zona pellucida glycoprotein 2 (sperm receptor)
chicken(427006) zona pellucida glycoprotein 2 (sperm receptor)
dog(403988) zona pellucida glycoprotein 2 (sperm receptor)
domestic cat(493977) zona pellucida glycoprotein 2 (sperm receptor)
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011775 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011775 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011775 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003460 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003460 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003460 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003460 Rosetta Predictions human pricing
NM_031150 Rosetta Predictions rat pricing
NM_011775 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239163 predicted 1255
2 SASI_Hs01_00239164 predicted 1541
3 SASI_Hs01_00239165 predicted 1984
4 SASI_Hs01_00239166 predicted 913
5 SASI_Hs01_00239167 predicted 1274
6 SASI_Hs02_00335707 predicted 1469
7 SASI_Hs01_00239169 predicted 1458
8 SASI_Hs01_00239170 predicted 897
9 SASI_Hs01_00239171 predicted 660
10 SASI_Hs01_00239172 predicted 1363
11 SASI_Hs01_00239168 predicted 1771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121922 predicted 1268
2 SASI_Rn01_00121923 predicted 1538
3 SASI_Rn01_00121924 predicted 1013
4 SASI_Rn02_00264493 predicted 836
5 SASI_Rn01_00121925 predicted 263
6 SASI_Rn01_00121926 predicted 357
7 SASI_Rn01_00121927 predicted 1725
8 SASI_Rn01_00121928 predicted 511
9 SASI_Rn01_00121929 predicted 1784
10 SASI_Rn01_00121930 predicted 1487
11 SASI_Rn01_00121931 predicted 1227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047885 predicted 615
2 SASI_Mm01_00047886 predicted 1768
3 SASI_Mm01_00047887 predicted 317
4 SASI_Mm02_00321422 predicted 460
5 SASI_Mm01_00047889 predicted 995
6 SASI_Mm01_00047890 predicted 671
7 SASI_Mm01_00047891 predicted 1249
8 SASI_Mm01_00047892 predicted 782
9 SASI_Mm01_00047893 predicted 1834
10 SASI_Mm01_00047894 predicted 1387
11 SASI_Mm01_00047888 predicted 1612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011775
ZP2 MISSION shRNA Bacterial Glycerol Stock
zona pellucida glycoprotein 2 (sperm receptor)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011775.3-2030s1c1
Sequence:CCGGGCTCTGAGATTACCAAGGATACTCGAGTATCCTTGGTAATCTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011775.3-212s1c1
Sequence:CCGGCAAGCAGATTTGACATGGAAACTCGAGTTTCCATGTCAAATCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011775.3-616s1c1
Sequence:CCGGGCCATAGTACAAGGATTTAATCTCGAGATTAAATCCTTGTACTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011775.3-1436s1c1
Sequence:CCGGCCCATGTCAAAGGACATCCTTCTCGAGAAGGATGTCCTTTGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011775.3-916s1c1
Sequence:CCGGGCCAATGGAATTGACAAAGAACTCGAGTTCTTTGTCAATTCCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011775
ZP2 MISSION shRNA shRNA Plasmid DNA
zona pellucida glycoprotein 2 (sperm receptor)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011775.3-2030s1c1
Sequence:CCGGGCTCTGAGATTACCAAGGATACTCGAGTATCCTTGGTAATCTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011775.3-212s1c1
Sequence:CCGGCAAGCAGATTTGACATGGAAACTCGAGTTTCCATGTCAAATCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011775.3-616s1c1
Sequence:CCGGGCCATAGTACAAGGATTTAATCTCGAGATTAAATCCTTGTACTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011775.3-1436s1c1
Sequence:CCGGCCCATGTCAAAGGACATCCTTCTCGAGAAGGATGTCCTTTGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011775.3-916s1c1
Sequence:CCGGGCCAATGGAATTGACAAAGAACTCGAGTTCTTTGTCAATTCCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011775
ZP2 MISSION shRNA Lentiviral Transduction Particles
zona pellucida glycoprotein 2 (sperm receptor)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011775.3-2030s1c1
Sequence:CCGGGCTCTGAGATTACCAAGGATACTCGAGTATCCTTGGTAATCTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011775.3-212s1c1
Sequence:CCGGCAAGCAGATTTGACATGGAAACTCGAGTTTCCATGTCAAATCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011775.3-616s1c1
Sequence:CCGGGCCATAGTACAAGGATTTAATCTCGAGATTAAATCCTTGTACTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011775.3-1436s1c1
Sequence:CCGGCCCATGTCAAAGGACATCCTTCTCGAGAAGGATGTCCTTTGACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011775.3-916s1c1
Sequence:CCGGGCCAATGGAATTGACAAAGAACTCGAGTTCTTTGTCAATTCCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003460
ZP2 MISSION shRNA Bacterial Glycerol Stock
zona pellucida glycoprotein 2 (sperm receptor)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003460.1-693s1c1
Sequence:CCGGGCAAGGTAACAGTCATCTCTACTCGAGTAGAGATGACTGTTACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003460.1-1501s1c1
Sequence:CCGGCCAGATAATTCCTACCAACAACTCGAGTTGTTGGTAGGAATTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003460.1-387s1c1
Sequence:CCGGCGGAGCTGTCATGTATCAGTTCTCGAGAACTGATACATGACAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003460.1-1606s1c1
Sequence:CCGGCCCAACATCAAGCTGGTCTTACTCGAGTAAGACCAGCTTGATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003460.1-152s1c1
Sequence:CCGGGCACTGTCACTTGCGATGAAACTCGAGTTTCATCGCAAGTGACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003460
ZP2 MISSION shRNA shRNA Plasmid DNA
zona pellucida glycoprotein 2 (sperm receptor)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003460.1-693s1c1
Sequence:CCGGGCAAGGTAACAGTCATCTCTACTCGAGTAGAGATGACTGTTACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003460.1-1501s1c1
Sequence:CCGGCCAGATAATTCCTACCAACAACTCGAGTTGTTGGTAGGAATTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003460.1-387s1c1
Sequence:CCGGCGGAGCTGTCATGTATCAGTTCTCGAGAACTGATACATGACAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003460.1-1606s1c1
Sequence:CCGGCCCAACATCAAGCTGGTCTTACTCGAGTAAGACCAGCTTGATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003460.1-152s1c1
Sequence:CCGGGCACTGTCACTTGCGATGAAACTCGAGTTTCATCGCAAGTGACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003460
ZP2 MISSION shRNA Lentiviral Transduction Particles
zona pellucida glycoprotein 2 (sperm receptor)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003460.1-693s1c1
Sequence:CCGGGCAAGGTAACAGTCATCTCTACTCGAGTAGAGATGACTGTTACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003460.1-1501s1c1
Sequence:CCGGCCAGATAATTCCTACCAACAACTCGAGTTGTTGGTAGGAATTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003460.1-387s1c1
Sequence:CCGGCGGAGCTGTCATGTATCAGTTCTCGAGAACTGATACATGACAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003460.1-1606s1c1
Sequence:CCGGCCCAACATCAAGCTGGTCTTACTCGAGTAAGACCAGCTTGATGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003460.1-152s1c1
Sequence:CCGGGCACTGTCACTTGCGATGAAACTCGAGTTTCATCGCAAGTGACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks