EMAIL THIS PAGE TO A FRIEND

ZP3

zona pellucida glycoprotein 3 (sperm receptor)

Synonyms: ZP3A ZP3B ZPC Zp-3
UniProtKB ID: P21754, Q06633, Q29RW0
Gene ID:
Human(7784) Summary: The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The protein encoded by this gene is a structural component of the zona pellucida and functions in primary binding and induction of the sperm acrosome reaction. The nascent protein contains a N-terminal signal peptide sequence, a conserved ZP domain, a C-terminal consensus furin cleavage site, and a transmembrane domain. It is hypothesized that furin cleavage results in release of the mature protein from the plasma membrane for subsequent incorporation into the zona pellucida matrix. However, the requirement for furin cleavage in this process remains controversial based on mouse studies. A variation in the last exon of this gene has previously served as the basis for an additional ZP3 locus; however, sequence and literature review reveals that there is only one full-length ZP3 locus in the human genome. Another locus encoding a bipartite transcript designated POMZP3 contains a duplication of the last four exons of ZP3, including the above described variation, and maps closely to this gene. [provided by RefSeq, Jul 2008]
Mouse(22788) zona pellucida glycoprotein 3
Rat(114639) zona pellucida glycoprotein 3 (sperm receptor)
Zebrafish(30594) zona pellucida glycoprotein 3
domestic cat(493925) zona pellucida glycoprotein 3 (sperm receptor)
dog(403894) zona pellucida glycoprotein 3 (sperm receptor)
chicken(378906) zona pellucida sperm-binding protein 3
cow(280964) zona pellucida glycoprotein 3 (sperm receptor)
sheep(101118580) zona pellucida glycoprotein 3 (sperm receptor)
domestic guinea pig(100729911) zona pellucida glycoprotein 3 (sperm receptor)
naked mole-rat(101717140) zona pellucida glycoprotein 3 (sperm receptor)
Domestic Rabbit(100009185) zona pellucida glycoprotein 3 (sperm receptor)
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007155 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007155 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007155 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011776 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011776 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011776 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115221 MISSION® esiRNA esiRNA human ZP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001110354 Rosetta Predictions human pricing
NM_007155 Rosetta Predictions human pricing
NM_053762 Rosetta Predictions rat pricing
NM_011776 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324915 predicted 320
2 SASI_Hs02_00324916 predicted 397
3 SASI_Hs02_00324917 predicted 688
4 SASI_Hs02_00324918 predicted 739
5 SASI_Hs02_00324919 predicted 302
6 SASI_Hs02_00324920 predicted 346
7 SASI_Hs02_00324921 predicted 809
8 SASI_Hs02_00324922 predicted 372
9 SASI_Hs02_00324923 predicted 713
10 SASI_Hs02_00324924 predicted 816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171579 predicted 497
2 SASI_Hs01_00171581 predicted 567
3 SASI_Hs01_00171582 predicted 864
4 SASI_Hs01_00171584 predicted 918
5 SASI_Hs01_00171585 predicted 476
6 SASI_Hs01_00171586 predicted 516
7 SASI_Hs01_00171587 predicted 987
8 SASI_Hs01_00171588 predicted 555
9 SASI_Hs02_00343067 predicted 898
10 SASI_Hs02_00343068 predicted 996
11 SASI_Hs01_00171580 predicted 422
12 SASI_Hs01_00171583 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071205 predicted 563
2 SASI_Rn01_00071206 predicted 360
3 SASI_Rn01_00071207 predicted 861
4 SASI_Rn01_00071208 predicted 290
5 SASI_Rn01_00071209 predicted 820
6 SASI_Rn01_00071210 predicted 388
7 SASI_Rn01_00071211 predicted 861
8 SASI_Rn01_00071212 predicted 996
9 SASI_Rn01_00071213 predicted 803
10 SASI_Rn02_00266546 predicted 810
11 SASI_Rn01_00071204 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011776 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073516 predicted 389
2 SASI_Mm01_00073517 predicted 743
3 SASI_Mm01_00073518 predicted 839
4 SASI_Mm01_00073519 predicted 859
5 SASI_Mm01_00073520 predicted 401
6 SASI_Mm01_00073521 predicted 809
7 SASI_Mm01_00073522 predicted 855
8 SASI_Mm01_00073523 predicted 810
9 SASI_Mm01_00073524 predicted 926
10 SASI_Mm01_00073525 predicted 752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007155
VALIDATED
ZP3 MISSION shRNA Bacterial Glycerol Stock
zona pellucida glycoprotein 3 (sperm receptor)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_007155.4-416s1c1
Sequence:CCGGACAGAAGATGTGGTCAGGTTTCTCGAGAAACCTGACCACATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007155.4-535s1c1
Sequence:CCGGCCTGTCCATCGTGAGGACTAACTCGAGTTAGTCCTCACGATGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007155.4-844s1c1
Sequence:CCGGCCCTTATCACACCATCGTGGACTCGAGTCCACGATGGTGTGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007155.4-558s1c1
Sequence:CCGGGCGCAGAGATTCCCATCGAGTCTCGAGACTCGATGGGAATCTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_007155.4-634s1c1
Sequence:CCGGGCCCTTCAGGACCACGGTGTTCTCGAGAACACCGTGGTCCTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007155.5-1128s21c1
Sequence:CCGGGCTCGGCTGACATCTGTCAATCTCGAGATTGACAGATGTCAGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007155.5-807s21c1
Sequence:CCGGACGTGCCACTGCGGTTGTTTGCTCGAGCAAACAACCGCAGTGGCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007155.5-696s21c1
Sequence:CCGGTGACTTTCTCTCTGCGTCTGACTCGAGTCAGACGCAGAGAGAAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007155.5-493s21c1
Sequence:CCGGCATGCAGGTAACTGACGATGCCTCGAGGCATCGTCAGTTACCTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007155
VALIDATED
ZP3 MISSION shRNA shRNA Plasmid DNA
zona pellucida glycoprotein 3 (sperm receptor)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_007155.4-416s1c1
Sequence:CCGGACAGAAGATGTGGTCAGGTTTCTCGAGAAACCTGACCACATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007155.4-535s1c1
Sequence:CCGGCCTGTCCATCGTGAGGACTAACTCGAGTTAGTCCTCACGATGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007155.4-844s1c1
Sequence:CCGGCCCTTATCACACCATCGTGGACTCGAGTCCACGATGGTGTGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007155.4-558s1c1
Sequence:CCGGGCGCAGAGATTCCCATCGAGTCTCGAGACTCGATGGGAATCTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_007155.4-634s1c1
Sequence:CCGGGCCCTTCAGGACCACGGTGTTCTCGAGAACACCGTGGTCCTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007155.5-1128s21c1
Sequence:CCGGGCTCGGCTGACATCTGTCAATCTCGAGATTGACAGATGTCAGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007155.5-807s21c1
Sequence:CCGGACGTGCCACTGCGGTTGTTTGCTCGAGCAAACAACCGCAGTGGCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007155.5-696s21c1
Sequence:CCGGTGACTTTCTCTCTGCGTCTGACTCGAGTCAGACGCAGAGAGAAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007155.5-493s21c1
Sequence:CCGGCATGCAGGTAACTGACGATGCCTCGAGGCATCGTCAGTTACCTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007155
VALIDATED
ZP3 MISSION shRNA Lentiviral Transduction Particles
zona pellucida glycoprotein 3 (sperm receptor)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_007155.4-416s1c1
Sequence:CCGGACAGAAGATGTGGTCAGGTTTCTCGAGAAACCTGACCACATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007155.4-535s1c1
Sequence:CCGGCCTGTCCATCGTGAGGACTAACTCGAGTTAGTCCTCACGATGGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_007155.4-844s1c1
Sequence:CCGGCCCTTATCACACCATCGTGGACTCGAGTCCACGATGGTGTGATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_007155.4-558s1c1
Sequence:CCGGGCGCAGAGATTCCCATCGAGTCTCGAGACTCGATGGGAATCTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_007155.4-634s1c1
Sequence:CCGGGCCCTTCAGGACCACGGTGTTCTCGAGAACACCGTGGTCCTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007155.5-1128s21c1
Sequence:CCGGGCTCGGCTGACATCTGTCAATCTCGAGATTGACAGATGTCAGCCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007155.5-807s21c1
Sequence:CCGGACGTGCCACTGCGGTTGTTTGCTCGAGCAAACAACCGCAGTGGCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007155.5-696s21c1
Sequence:CCGGTGACTTTCTCTCTGCGTCTGACTCGAGTCAGACGCAGAGAGAAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007155.5-493s21c1
Sequence:CCGGCATGCAGGTAACTGACGATGCCTCGAGGCATCGTCAGTTACCTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011776
ZP3 MISSION shRNA Bacterial Glycerol Stock
zona pellucida glycoprotein 3 (sperm receptor)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011776.1-917s1c1
Sequence:CCGGGCTCAACAAAGCCTGTTCGTTCTCGAGAACGAACAGGCTTTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011776.1-850s1c1
Sequence:CCGGGCTCCAGAAATACGCTCTACACTCGAGTGTAGAGCGTATTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011776.1-561s1c1
Sequence:CCGGGAGAACTGGAATACTGAGAAACTCGAGTTTCTCAGTATTCCAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011776.1-562s1c1
Sequence:CCGGAGAACTGGAATACTGAGAAATCTCGAGATTTCTCAGTATTCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011776.1-851s1c1
Sequence:CCGGCTCCAGAAATACGCTCTACATCTCGAGATGTAGAGCGTATTTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011776
ZP3 MISSION shRNA shRNA Plasmid DNA
zona pellucida glycoprotein 3 (sperm receptor)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011776.1-917s1c1
Sequence:CCGGGCTCAACAAAGCCTGTTCGTTCTCGAGAACGAACAGGCTTTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011776.1-850s1c1
Sequence:CCGGGCTCCAGAAATACGCTCTACACTCGAGTGTAGAGCGTATTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011776.1-561s1c1
Sequence:CCGGGAGAACTGGAATACTGAGAAACTCGAGTTTCTCAGTATTCCAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011776.1-562s1c1
Sequence:CCGGAGAACTGGAATACTGAGAAATCTCGAGATTTCTCAGTATTCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011776.1-851s1c1
Sequence:CCGGCTCCAGAAATACGCTCTACATCTCGAGATGTAGAGCGTATTTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011776
ZP3 MISSION shRNA Lentiviral Transduction Particles
zona pellucida glycoprotein 3 (sperm receptor)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011776.1-917s1c1
Sequence:CCGGGCTCAACAAAGCCTGTTCGTTCTCGAGAACGAACAGGCTTTGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011776.1-850s1c1
Sequence:CCGGGCTCCAGAAATACGCTCTACACTCGAGTGTAGAGCGTATTTCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011776.1-561s1c1
Sequence:CCGGGAGAACTGGAATACTGAGAAACTCGAGTTTCTCAGTATTCCAGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011776.1-562s1c1
Sequence:CCGGAGAACTGGAATACTGAGAAATCTCGAGATTTCTCAGTATTCCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011776.1-851s1c1
Sequence:CCGGCTCCAGAAATACGCTCTACATCTCGAGATGTAGAGCGTATTTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks