EMAIL THIS PAGE TO A FRIEND

ZP4

zona pellucida glycoprotein 4

Synonyms: ZBP ZP1 ZPB Zp-4
UniProtKB ID: Q12836, B2RAE1
Gene ID:
Human(57829) Summary: The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The nascent protein contains a N-terminal signal peptide sequence, a conserved ZP domain, a consensus furin cleavage site, and a C-terminal transmembrane domain. It is hypothesized that furin cleavage results in release of the mature protein from the plasma membrane for subsequent incorporation into the zona pellucida matrix. However, the requirement for furin cleavage in this process remains controversial based on mouse studies. Previously, this gene has been referred to as ZP1 or ZPB and thought to have similar functions as mouse Zp1. However, a human gene with higher similarity and chromosomal synteny to mouse Zp1 has been assigned the symbol ZP1 and this gene has been assigned the symbol ZP4. [provided by RefSeq, Jul 2008]
Rat(282833) zona pellucida glycoprotein 4
cow(280965) zona pellucida glycoprotein 4
sheep(101117046) zona pellucida glycoprotein 4
domestic guinea pig(100731580) zona pellucida glycoprotein 4
Domestic Rabbit(100009131) zona pellucida glycoprotein 4
naked mole-rat(101719754) zona pellucida glycoprotein 4
chicken(395692) zona pellucida glycoprotein 4
domestic cat(493791) zona pellucida glycoprotein 4
dog(442977) zona pellucida glycoprotein 4
37 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021186 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021186 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021186 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021186 Rosetta Predictions human pricing
NM_172330 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107240 predicted 481
2 SASI_Hs01_00107241 predicted 409
3 SASI_Hs01_00107242 predicted 991
4 SASI_Hs01_00107243 predicted 978
5 SASI_Hs01_00107244 predicted 1376
6 SASI_Hs01_00107245 predicted 877
7 SASI_Hs01_00107246 predicted 950
8 SASI_Hs01_00107247 predicted 659
9 SASI_Hs01_00107248 predicted 411
10 SASI_Hs01_00107249 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084078 predicted 1039
2 SASI_Rn01_00084080 predicted 199
3 SASI_Rn02_00269221 predicted 761
4 SASI_Rn02_00269222 predicted 235
5 SASI_Rn01_00084082 predicted 743
6 SASI_Rn01_00084083 predicted 1218
7 SASI_Rn01_00084084 predicted 1255
8 SASI_Rn01_00084085 predicted 673
9 SASI_Rn01_00084086 predicted 235
10 SASI_Rn01_00084087 predicted 1360
11 SASI_Rn01_00084079 predicted 773
12 SASI_Rn01_00084081 predicted 452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021186
ZP4 MISSION shRNA Bacterial Glycerol Stock
zona pellucida glycoprotein 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021186.2-1165s1c1
Sequence:CCGGCCCTACATTGGAGACAACTATCTCGAGATAGTTGTCTCCAATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021186.2-265s1c1
Sequence:CCGGGCAACCTATAGCAGCTGCTATCTCGAGATAGCAGCTGCTATAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021186.2-1262s1c1
Sequence:CCGGCCTTCAGCTTTGTGAACCCTACTCGAGTAGGGTTCACAAAGCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021186.2-949s1c1
Sequence:CCGGCTGGAACTTCAGATTGCCAAACTCGAGTTTGGCAATCTGAAGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021186.2-152s1c1
Sequence:CCGGCTCCTCCTGTACTAATAGCTTCTCGAGAAGCTATTAGTACAGGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021186.2-495s21c1
Sequence:CCGGAGGGCTAGGCTGTTGTTATAGCTCGAGCTATAACAACAGCCTAGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021186.2-744s21c1
Sequence:CCGGCACTGGAGACCGAGCAGTATACTCGAGTATACTGCTCGGTCTCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021186.2-652s21c1
Sequence:CCGGAGGAATGACAGTGCGTGTAACCTCGAGGTTACACGCACTGTCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021186
ZP4 MISSION shRNA shRNA Plasmid DNA
zona pellucida glycoprotein 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021186.2-1165s1c1
Sequence:CCGGCCCTACATTGGAGACAACTATCTCGAGATAGTTGTCTCCAATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021186.2-265s1c1
Sequence:CCGGGCAACCTATAGCAGCTGCTATCTCGAGATAGCAGCTGCTATAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021186.2-1262s1c1
Sequence:CCGGCCTTCAGCTTTGTGAACCCTACTCGAGTAGGGTTCACAAAGCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021186.2-949s1c1
Sequence:CCGGCTGGAACTTCAGATTGCCAAACTCGAGTTTGGCAATCTGAAGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021186.2-152s1c1
Sequence:CCGGCTCCTCCTGTACTAATAGCTTCTCGAGAAGCTATTAGTACAGGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021186.2-495s21c1
Sequence:CCGGAGGGCTAGGCTGTTGTTATAGCTCGAGCTATAACAACAGCCTAGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021186.2-744s21c1
Sequence:CCGGCACTGGAGACCGAGCAGTATACTCGAGTATACTGCTCGGTCTCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021186.2-652s21c1
Sequence:CCGGAGGAATGACAGTGCGTGTAACCTCGAGGTTACACGCACTGTCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021186
ZP4 MISSION shRNA Lentiviral Transduction Particles
zona pellucida glycoprotein 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021186.2-1165s1c1
Sequence:CCGGCCCTACATTGGAGACAACTATCTCGAGATAGTTGTCTCCAATGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021186.2-265s1c1
Sequence:CCGGGCAACCTATAGCAGCTGCTATCTCGAGATAGCAGCTGCTATAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021186.2-1262s1c1
Sequence:CCGGCCTTCAGCTTTGTGAACCCTACTCGAGTAGGGTTCACAAAGCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021186.2-949s1c1
Sequence:CCGGCTGGAACTTCAGATTGCCAAACTCGAGTTTGGCAATCTGAAGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021186.2-152s1c1
Sequence:CCGGCTCCTCCTGTACTAATAGCTTCTCGAGAAGCTATTAGTACAGGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021186.2-495s21c1
Sequence:CCGGAGGGCTAGGCTGTTGTTATAGCTCGAGCTATAACAACAGCCTAGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021186.2-744s21c1
Sequence:CCGGCACTGGAGACCGAGCAGTATACTCGAGTATACTGCTCGGTCTCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021186.2-652s21c1
Sequence:CCGGAGGAATGACAGTGCGTGTAACCTCGAGGTTACACGCACTGTCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks