EMAIL THIS PAGE TO A FRIEND

ZPBP2

zona pellucida binding protein 2

Synonyms: ZPBPL
UniProtKB ID: Q6X784, A8K8L8, Q6X783, Q86XL5
Gene ID:
Mouse(69376) zona pellucida binding protein 2
Rat(363676) zona pellucida binding protein 2
domestic guinea pig(100725290) zona pellucida binding protein 2
naked mole-rat(101703427) zona pellucida binding protein 2
cow(514334) zona pellucida binding protein 2
sheep(101104840) zona pellucida binding protein 2
chicken(404532) zona pellucida binding protein 2
domestic cat(101101601) zona pellucida binding protein 2
dog(480531) zona pellucida binding protein 2
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027061 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027061 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027061 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198844 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198844 Rosetta Predictions human pricing
NM_199321 Rosetta Predictions human pricing
NM_001007011 Rosetta Predictions rat pricing
NM_027061 Rosetta Predictions mouse pricing
NM_199419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149424 predicted 680
2 SASI_Hs01_00149425 predicted 1163
3 SASI_Hs02_00372352 predicted 897
4 SASI_Hs01_00149426 predicted 463
5 SASI_Hs01_00149428 predicted 1047
6 SASI_Hs01_00149429 predicted 726
7 SASI_Hs01_00149430 predicted 745
8 SASI_Hs01_00149431 predicted 1169
9 SASI_Hs02_00372353 predicted 757
10 SASI_Hs01_00149433 predicted 702
11 SASI_Hs01_00149427 predicted 759
12 SASI_Hs01_00149432 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040527 predicted 740
2 SASI_Hs01_00040528 predicted 1228
3 SASI_Hs02_00372729 predicted 957
4 SASI_Hs01_00040529 predicted 537
5 SASI_Hs01_00040531 predicted 1117
6 SASI_Hs01_00040532 predicted 796
7 SASI_Hs01_00040533 predicted 810
8 SASI_Hs01_00040534 predicted 1238
9 SASI_Hs02_00372730 predicted 830
10 SASI_Hs01_00040536 predicted 768
11 SASI_Hs01_00040530 predicted 830
12 SASI_Hs01_00040535 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007011 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198600 predicted 488
2 SASI_Rn01_00034109 predicted 903
3 SASI_Rn01_00034110 predicted 1153
4 SASI_Rn01_00034111 predicted 565
5 SASI_Rn01_00034112 predicted 512
6 SASI_Rn01_00034114 predicted 605
7 SASI_Rn01_00034115 predicted 308
8 SASI_Rn01_00034116 predicted 1168
9 SASI_Rn02_00198601 predicted 628
10 SASI_Rn01_00034117 predicted 472
11 SASI_Rn01_00034108 predicted 466
12 SASI_Rn01_00034113 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027061 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186356 predicted 262
2 SASI_Mm01_00186357 predicted 284
3 SASI_Mm01_00186358 predicted 1068
4 SASI_Mm01_00186360 predicted 263
5 SASI_Mm01_00186361 predicted 270
6 SASI_Mm01_00186362 predicted 1153
7 SASI_Mm01_00186363 predicted 969
8 SASI_Mm01_00186364 predicted 1172
9 SASI_Mm02_00331481 predicted 1227
10 SASI_Mm02_00331482 predicted 1220
11 SASI_Mm01_00186355 predicted 1078
12 SASI_Mm01_00186359 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070804 predicted 257
2 SASI_Mm01_00070805 predicted 287
3 SASI_Mm01_00070806 predicted 845
4 SASI_Mm01_00070808 predicted 264
5 SASI_Mm01_00070809 predicted 264
6 SASI_Mm01_00070810 predicted 931
7 SASI_Mm01_00070811 predicted 754
8 SASI_Mm01_00070812 predicted 961
9 SASI_Mm02_00351461 predicted 1013
10 SASI_Mm02_00351462 predicted 1001
11 SASI_Mm01_00070803 predicted 860
12 SASI_Mm01_00070807 predicted 769
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027061
ZPBP2 MISSION shRNA Bacterial Glycerol Stock
zona pellucida binding protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027061.1-659s1c1
Sequence:CCGGCCATGTCATAGAGCCATCATACTCGAGTATGATGGCTCTATGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027061.1-527s21c1
Sequence:CCGGATATCGGGAACCTGATTATTCCTCGAGGAATAATCAGGTTCCCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027061.1-263s21c1
Sequence:CCGGGGCTAGTCCTGTCCTTATTTGCTCGAGCAAATAAGGACAGGACTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027061.1-1281s21c1
Sequence:CCGGGCTTCTGAGAAGGCATTTATCCTCGAGGATAAATGCCTTCTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027061.1-1085s21c1
Sequence:CCGGAGCTAAAGCTTGCCCATAAACCTCGAGGTTTATGGGCAAGCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027061.1-480s1c1
Sequence:CCGGCAAGAAGAAACTATGATAAAGCTCGAGCTTTATCATAGTTTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027061.1-525s1c1
Sequence:CCGGGCATATCGGGAACCTGATTATCTCGAGATAATCAGGTTCCCGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027061.1-182s21c1
Sequence:CCGGACGTTCTTCCTTATTCAATATCTCGAGATATTGAATAAGGAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027061
ZPBP2 MISSION shRNA shRNA Plasmid DNA
zona pellucida binding protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027061.1-659s1c1
Sequence:CCGGCCATGTCATAGAGCCATCATACTCGAGTATGATGGCTCTATGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027061.1-527s21c1
Sequence:CCGGATATCGGGAACCTGATTATTCCTCGAGGAATAATCAGGTTCCCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027061.1-263s21c1
Sequence:CCGGGGCTAGTCCTGTCCTTATTTGCTCGAGCAAATAAGGACAGGACTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027061.1-1281s21c1
Sequence:CCGGGCTTCTGAGAAGGCATTTATCCTCGAGGATAAATGCCTTCTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027061.1-1085s21c1
Sequence:CCGGAGCTAAAGCTTGCCCATAAACCTCGAGGTTTATGGGCAAGCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027061.1-480s1c1
Sequence:CCGGCAAGAAGAAACTATGATAAAGCTCGAGCTTTATCATAGTTTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027061.1-525s1c1
Sequence:CCGGGCATATCGGGAACCTGATTATCTCGAGATAATCAGGTTCCCGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027061.1-182s21c1
Sequence:CCGGACGTTCTTCCTTATTCAATATCTCGAGATATTGAATAAGGAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027061
ZPBP2 MISSION shRNA Lentiviral Transduction Particles
zona pellucida binding protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027061.1-659s1c1
Sequence:CCGGCCATGTCATAGAGCCATCATACTCGAGTATGATGGCTCTATGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027061.1-527s21c1
Sequence:CCGGATATCGGGAACCTGATTATTCCTCGAGGAATAATCAGGTTCCCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027061.1-263s21c1
Sequence:CCGGGGCTAGTCCTGTCCTTATTTGCTCGAGCAAATAAGGACAGGACTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249411    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027061.1-1281s21c1
Sequence:CCGGGCTTCTGAGAAGGCATTTATCCTCGAGGATAAATGCCTTCTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027061.1-1085s21c1
Sequence:CCGGAGCTAAAGCTTGCCCATAAACCTCGAGGTTTATGGGCAAGCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027061.1-480s1c1
Sequence:CCGGCAAGAAGAAACTATGATAAAGCTCGAGCTTTATCATAGTTTCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027061.1-525s1c1
Sequence:CCGGGCATATCGGGAACCTGATTATCTCGAGATAATCAGGTTCCCGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027061.1-182s21c1
Sequence:CCGGACGTTCTTCCTTATTCAATATCTCGAGATATTGAATAAGGAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198844
ZPBP2 MISSION shRNA Bacterial Glycerol Stock
zona pellucida binding protein 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198844.1-1820s1c1
Sequence:CCGGGCAGTCTCATACAGAATAGTTCTCGAGAACTATTCTGTATGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198844.1-746s1c1
Sequence:CCGGGACTGTGAAGATACCACTAATCTCGAGATTAGTGGTATCTTCACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198844.2-820s21c1
Sequence:CCGGTTTCGGAGCCAAGCATATATTCTCGAGAATATATGCTTGGCTCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198844.2-630s21c1
Sequence:CCGGTGTCATAGAGCCATCATATAACTCGAGTTATATGATGGCTCTATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198844.2-680s21c1
Sequence:CCGGGCCTCATACATGAGCTATTTACTCGAGTAAATAGCTCATGTATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198844.2-494s21c1
Sequence:CCGGCCTATCGGGAACCTGATTATTCTCGAGAATAATCAGGTTCCCGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198844
ZPBP2 MISSION shRNA shRNA Plasmid DNA
zona pellucida binding protein 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198844.1-1820s1c1
Sequence:CCGGGCAGTCTCATACAGAATAGTTCTCGAGAACTATTCTGTATGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198844.1-746s1c1
Sequence:CCGGGACTGTGAAGATACCACTAATCTCGAGATTAGTGGTATCTTCACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198844.2-820s21c1
Sequence:CCGGTTTCGGAGCCAAGCATATATTCTCGAGAATATATGCTTGGCTCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198844.2-630s21c1
Sequence:CCGGTGTCATAGAGCCATCATATAACTCGAGTTATATGATGGCTCTATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198844.2-680s21c1
Sequence:CCGGGCCTCATACATGAGCTATTTACTCGAGTAAATAGCTCATGTATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198844.2-494s21c1
Sequence:CCGGCCTATCGGGAACCTGATTATTCTCGAGAATAATCAGGTTCCCGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198844
ZPBP2 MISSION shRNA Lentiviral Transduction Particles
zona pellucida binding protein 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198844.1-1820s1c1
Sequence:CCGGGCAGTCTCATACAGAATAGTTCTCGAGAACTATTCTGTATGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198844.1-746s1c1
Sequence:CCGGGACTGTGAAGATACCACTAATCTCGAGATTAGTGGTATCTTCACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198844.2-820s21c1
Sequence:CCGGTTTCGGAGCCAAGCATATATTCTCGAGAATATATGCTTGGCTCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198844.2-630s21c1
Sequence:CCGGTGTCATAGAGCCATCATATAACTCGAGTTATATGATGGCTCTATGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198844.2-680s21c1
Sequence:CCGGGCCTCATACATGAGCTATTTACTCGAGTAAATAGCTCATGTATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198844.2-494s21c1
Sequence:CCGGCCTATCGGGAACCTGATTATTCTCGAGAATAATCAGGTTCCCGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks