EMAIL THIS PAGE TO A FRIEND

ZPBP

zona pellucida binding protein

Synonyms: ZPBP1
UniProtKB ID: Q9BS86, A4D253, C9JPU1, Q15941, Q75KX9, Q75MI3
Gene ID:
Human(11055) Summary: ZPBP is one of several proteins that are thought to participate in secondary binding between acrosome-reacted sperm and the egg-specific extracellular matrix, the zona pellucida (McLeskey et al., 1998 [PubMed 9378618]
Mouse(53604) zona pellucida binding protein
Rat(498415) zona pellucida binding protein
chicken(404537) zona pellucida binding protein
domestic cat(101085189) zona pellucida binding protein
dog(607557) zona pellucida binding protein
cow(654401) zona pellucida binding protein
sheep(101107693) zona pellucida binding protein
naked mole-rat(101701072) zona pellucida binding protein
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007009 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007009 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007009 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007009 Rosetta Predictions human pricing
NM_001025139 Rosetta Predictions rat pricing
NM_015785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145473 predicted 699
2 SASI_Hs01_00145475 predicted 572
3 SASI_Hs01_00145476 predicted 426
4 SASI_Hs01_00145477 predicted 625
5 SASI_Hs01_00145478 predicted 340
6 SASI_Hs01_00145479 predicted 670
7 SASI_Hs01_00145480 predicted 290
8 SASI_Hs01_00145481 predicted 530
9 SASI_Hs01_00145482 predicted 300
10 SASI_Hs02_00342765 predicted 387
11 SASI_Hs01_00145474 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091460 predicted 1153
2 SASI_Rn01_00091461 predicted 1043
3 SASI_Rn01_00091462 predicted 921
4 SASI_Rn01_00091463 predicted 1117
5 SASI_Rn01_00091464 predicted 451
6 SASI_Rn01_00091465 predicted 600
7 SASI_Rn01_00091466 predicted 407
8 SASI_Rn01_00091467 predicted 715
9 SASI_Rn02_00203067 predicted 495
10 SASI_Rn01_00091468 predicted 680
11 SASI_Rn01_00091469 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194629 predicted 874
2 SASI_Mm01_00194630 predicted 828
3 SASI_Mm01_00194631 predicted 689
4 SASI_Mm01_00194632 predicted 1006
5 SASI_Mm01_00194633 predicted 557
6 SASI_Mm01_00194634 predicted 1005
7 SASI_Mm01_00194635 predicted 851
8 SASI_Mm02_00323147 predicted 956
9 SASI_Mm01_00194637 predicted 644
10 SASI_Mm01_00194638 predicted 630
11 SASI_Mm01_00194636 predicted 691
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015785
ZPBP MISSION shRNA Bacterial Glycerol Stock
zona pellucida binding protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015785.1-760s21c1
Sequence:CCGGGCAACAGTATCTATAACATTTCTCGAGAAATGTTATAGATACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015785.1-1122s21c1
Sequence:CCGGTTTCCAGGGTATGGCATAAATCTCGAGATTTATGCCATACCCTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015785.1-576s21c1
Sequence:CCGGTCCACAGGAAGCCTCATATTTCTCGAGAAATATGAGGCTTCCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015785.1-854s21c1
Sequence:CCGGGTCTGAATGCCATCGTGTTAACTCGAGTTAACACGATGGCATTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015785.1-854s1c1
Sequence:CCGGGTCTGAATGCCATCGTGTTAACTCGAGTTAACACGATGGCATTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015785.1-760s1c1
Sequence:CCGGGCAACAGTATCTATAACATTTCTCGAGAAATGTTATAGATACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015785.1-654s21c1
Sequence:CCGGACTGTAGAGGAATCTATTAAACTCGAGTTTAATAGATTCCTCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015785.1-651s1c1
Sequence:CCGGCCAACTGTAGAGGAATCTATTCTCGAGAATAGATTCCTCTACAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015785.1-832s1c1
Sequence:CCGGCCTGTGAAATATCCTTGATTACTCGAGTAATCAAGGATATTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015785.1-472s1c1
Sequence:CCGGGTGTAACCCAACGACTGAGAACTCGAGTTCTCAGTCGTTGGGTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015785
ZPBP MISSION shRNA shRNA Plasmid DNA
zona pellucida binding protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015785.1-760s21c1
Sequence:CCGGGCAACAGTATCTATAACATTTCTCGAGAAATGTTATAGATACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015785.1-1122s21c1
Sequence:CCGGTTTCCAGGGTATGGCATAAATCTCGAGATTTATGCCATACCCTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015785.1-576s21c1
Sequence:CCGGTCCACAGGAAGCCTCATATTTCTCGAGAAATATGAGGCTTCCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015785.1-854s21c1
Sequence:CCGGGTCTGAATGCCATCGTGTTAACTCGAGTTAACACGATGGCATTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015785.1-854s1c1
Sequence:CCGGGTCTGAATGCCATCGTGTTAACTCGAGTTAACACGATGGCATTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015785.1-760s1c1
Sequence:CCGGGCAACAGTATCTATAACATTTCTCGAGAAATGTTATAGATACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015785.1-654s21c1
Sequence:CCGGACTGTAGAGGAATCTATTAAACTCGAGTTTAATAGATTCCTCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015785.1-651s1c1
Sequence:CCGGCCAACTGTAGAGGAATCTATTCTCGAGAATAGATTCCTCTACAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015785.1-832s1c1
Sequence:CCGGCCTGTGAAATATCCTTGATTACTCGAGTAATCAAGGATATTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015785.1-472s1c1
Sequence:CCGGGTGTAACCCAACGACTGAGAACTCGAGTTCTCAGTCGTTGGGTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015785
ZPBP MISSION shRNA Lentiviral Transduction Particles
zona pellucida binding protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015785.1-760s21c1
Sequence:CCGGGCAACAGTATCTATAACATTTCTCGAGAAATGTTATAGATACTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015785.1-1122s21c1
Sequence:CCGGTTTCCAGGGTATGGCATAAATCTCGAGATTTATGCCATACCCTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015785.1-576s21c1
Sequence:CCGGTCCACAGGAAGCCTCATATTTCTCGAGAAATATGAGGCTTCCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015785.1-854s21c1
Sequence:CCGGGTCTGAATGCCATCGTGTTAACTCGAGTTAACACGATGGCATTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015785.1-854s1c1
Sequence:CCGGGTCTGAATGCCATCGTGTTAACTCGAGTTAACACGATGGCATTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015785.1-760s1c1
Sequence:CCGGGCAACAGTATCTATAACATTTCTCGAGAAATGTTATAGATACTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015785.1-654s21c1
Sequence:CCGGACTGTAGAGGAATCTATTAAACTCGAGTTTAATAGATTCCTCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015785.1-651s1c1
Sequence:CCGGCCAACTGTAGAGGAATCTATTCTCGAGAATAGATTCCTCTACAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015785.1-832s1c1
Sequence:CCGGCCTGTGAAATATCCTTGATTACTCGAGTAATCAAGGATATTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182485    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015785.1-472s1c1
Sequence:CCGGGTGTAACCCAACGACTGAGAACTCGAGTTCTCAGTCGTTGGGTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007009
ZPBP MISSION shRNA Bacterial Glycerol Stock
zona pellucida binding protein
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000136509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007009.1-314s1c1
Sequence:CCGGCTGAACTGATAGACCCATCATCTCGAGATGATGGGTCTATCAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007009.1-386s1c1
Sequence:CCGGCACAAATAACATCCACAGGAACTCGAGTTCCTGTGGATGTTATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007009.1-925s1c1
Sequence:CCGGGTTTGGATTAATCGCTGCTTTCTCGAGAAAGCAGCGATTAATCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007009.1-163s1c1
Sequence:CCGGGTTGGACACTTGGTTCGATTACTCGAGTAATCGAACCAAGTGTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007009
ZPBP MISSION shRNA shRNA Plasmid DNA
zona pellucida binding protein
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000136509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007009.1-314s1c1
Sequence:CCGGCTGAACTGATAGACCCATCATCTCGAGATGATGGGTCTATCAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007009.1-386s1c1
Sequence:CCGGCACAAATAACATCCACAGGAACTCGAGTTCCTGTGGATGTTATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007009.1-925s1c1
Sequence:CCGGGTTTGGATTAATCGCTGCTTTCTCGAGAAAGCAGCGATTAATCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007009.1-163s1c1
Sequence:CCGGGTTGGACACTTGGTTCGATTACTCGAGTAATCGAACCAAGTGTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007009
ZPBP MISSION shRNA Lentiviral Transduction Particles
zona pellucida binding protein
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000136509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007009.1-314s1c1
Sequence:CCGGCTGAACTGATAGACCCATCATCTCGAGATGATGGGTCTATCAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007009.1-386s1c1
Sequence:CCGGCACAAATAACATCCACAGGAACTCGAGTTCCTGTGGATGTTATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007009.1-925s1c1
Sequence:CCGGGTTTGGATTAATCGCTGCTTTCTCGAGAAAGCAGCGATTAATCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007009.1-163s1c1
Sequence:CCGGGTTGGACACTTGGTTCGATTACTCGAGTAATCGAACCAAGTGTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks