EMAIL THIS PAGE TO A FRIEND

ZRANB1

zinc finger, RAN-binding domain containing 1

Synonyms: TRABID
UniProtKB ID: Q9UGI0, B4DZ98, D3DRF4, Q5SQP6, Q69YK3
Gene ID:
Mouse(360216) zinc finger, RAN-binding domain containing 1
Rat(293571) zinc finger, RAN-binding domain containing 1
chicken(423953) zinc finger, RAN-binding domain containing 1
domestic cat(101098896) zinc finger, RAN-binding domain containing 1
dog(486931) zinc finger, RAN-binding domain containing 1
domestic guinea pig(100734408) zinc finger, RAN-binding domain containing 1
naked mole-rat(101723409) zinc finger, RAN-binding domain containing 1
cow(523338) zinc finger, RAN-binding domain containing 1
sheep(101114991) zinc finger, RAN-binding domain containing 1
127 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207302 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207302 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207302 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017580 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017580 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017580 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151931 MISSION® esiRNA esiRNA human ZRANB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017580 Rosetta Predictions human pricing
XM_215101 Rosetta Predictions rat pricing
NM_207302 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155779 predicted 1095
2 SASI_Hs02_00350242 predicted 1277
3 SASI_Hs02_00350243 predicted 894
4 SASI_Hs01_00155780 predicted 1629
5 SASI_Hs01_00155781 predicted 877
6 SASI_Hs01_00155782 predicted 1374
7 SASI_Hs01_00155785 predicted 1219
8 SASI_Hs01_00155786 predicted 1018
9 SASI_Hs02_00350244 predicted 768
10 SASI_Hs01_00155784 predicted 1871
11 SASI_Hs01_00155783 predicted 1607
12 SASI_Hs01_00155787 predicted 1484
13 SASI_Hs01_00155788 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215101 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00158549 predicted 1678
2 SASI_Rn01_00158550 predicted 208
3 SASI_Rn01_00158551 predicted 729
4 SASI_Rn01_00158552 predicted 521
5 SASI_Rn01_00158553 predicted 442
6 SASI_Rn01_00158554 predicted 1578
7 SASI_Rn01_00158555 predicted 1350
8 SASI_Rn01_00158556 predicted 1084
9 SASI_Rn01_00158557 predicted 1931
10 SASI_Rn01_00158558 predicted 1801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207302 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182841 predicted 1605
2 SASI_Mm01_00182842 predicted 776
3 SASI_Mm01_00182843 predicted 863
4 SASI_Mm01_00182844 predicted 1202
5 SASI_Mm01_00182845 predicted 1246
6 SASI_Mm01_00182846 predicted 981
7 SASI_Mm01_00182847 predicted 1129
8 SASI_Mm01_00182848 predicted 447
9 SASI_Mm01_00182849 predicted 368
10 SASI_Mm01_00182850 predicted 1452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207302
VALIDATED
ZRANB1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, RAN-binding domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207302.1-523s1c1
Sequence:CCGGCCCAGACCTAATAACATTGAACTCGAGTTCAATGTTATTAGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207302.1-1810s1c1
Sequence:CCGGGCTAATCTGAACACTGATGATCTCGAGATCATCAGTGTTCAGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207302.1-56s1c1
Sequence:CCGGCGTCTGCAATCAAGTGTACTACTCGAGTAGTACACTTGATTGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207302.1-1406s1c1
Sequence:CCGGGCCTGCATGACTGTTCACATTCTCGAGAATGTGAACAGTCATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207302.1-986s1c1
Sequence:CCGGCGATATTGCTTACAGAGGTATCTCGAGATACCTCTGTAAGCAATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207302.1-1593s21c1
Sequence:CCGGTATTCTTAGACGACCAATTATCTCGAGATAATTGGTCGTCTAAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207302.1-516s21c1
Sequence:CCGGTGACCATCCCAGACCTAATAACTCGAGTTATTAGGTCTGGGATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207302.1-1280s21c1
Sequence:CCGGGTCTGGACAGTAGACTATATGCTCGAGCATATAGTCTACTGTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207302.1-1406s21c1
Sequence:CCGGGCCTGCATGACTGTTCACATTCTCGAGAATGTGAACAGTCATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207302.1-972s21c1
Sequence:CCGGGCAGGACATGTTAGCGATATTCTCGAGAATATCGCTAACATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207302
VALIDATED
ZRANB1 MISSION shRNA shRNA Plasmid DNA
zinc finger, RAN-binding domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207302.1-523s1c1
Sequence:CCGGCCCAGACCTAATAACATTGAACTCGAGTTCAATGTTATTAGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207302.1-1810s1c1
Sequence:CCGGGCTAATCTGAACACTGATGATCTCGAGATCATCAGTGTTCAGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207302.1-56s1c1
Sequence:CCGGCGTCTGCAATCAAGTGTACTACTCGAGTAGTACACTTGATTGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207302.1-1406s1c1
Sequence:CCGGGCCTGCATGACTGTTCACATTCTCGAGAATGTGAACAGTCATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207302.1-986s1c1
Sequence:CCGGCGATATTGCTTACAGAGGTATCTCGAGATACCTCTGTAAGCAATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207302.1-1593s21c1
Sequence:CCGGTATTCTTAGACGACCAATTATCTCGAGATAATTGGTCGTCTAAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207302.1-516s21c1
Sequence:CCGGTGACCATCCCAGACCTAATAACTCGAGTTATTAGGTCTGGGATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207302.1-1280s21c1
Sequence:CCGGGTCTGGACAGTAGACTATATGCTCGAGCATATAGTCTACTGTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207302.1-1406s21c1
Sequence:CCGGGCCTGCATGACTGTTCACATTCTCGAGAATGTGAACAGTCATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207302.1-972s21c1
Sequence:CCGGGCAGGACATGTTAGCGATATTCTCGAGAATATCGCTAACATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207302
VALIDATED
ZRANB1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, RAN-binding domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207302.1-523s1c1
Sequence:CCGGCCCAGACCTAATAACATTGAACTCGAGTTCAATGTTATTAGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207302.1-1810s1c1
Sequence:CCGGGCTAATCTGAACACTGATGATCTCGAGATCATCAGTGTTCAGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207302.1-56s1c1
Sequence:CCGGCGTCTGCAATCAAGTGTACTACTCGAGTAGTACACTTGATTGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207302.1-1406s1c1
Sequence:CCGGGCCTGCATGACTGTTCACATTCTCGAGAATGTGAACAGTCATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207302.1-986s1c1
Sequence:CCGGCGATATTGCTTACAGAGGTATCTCGAGATACCTCTGTAAGCAATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207302.1-1593s21c1
Sequence:CCGGTATTCTTAGACGACCAATTATCTCGAGATAATTGGTCGTCTAAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207302.1-516s21c1
Sequence:CCGGTGACCATCCCAGACCTAATAACTCGAGTTATTAGGTCTGGGATGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207302.1-1280s21c1
Sequence:CCGGGTCTGGACAGTAGACTATATGCTCGAGCATATAGTCTACTGTCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207302.1-1406s21c1
Sequence:CCGGGCCTGCATGACTGTTCACATTCTCGAGAATGTGAACAGTCATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207302.1-972s21c1
Sequence:CCGGGCAGGACATGTTAGCGATATTCTCGAGAATATCGCTAACATGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017580
VALIDATED
ZRANB1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, RAN-binding domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017580.1-2523s1c1
Sequence:CCGGCCAAGGCATCAGATCTGTAATCTCGAGATTACAGATCTGATGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017580.1-991s1c1
Sequence:CCGGGCAGTAGTGGTAATAGCCAAACTCGAGTTTGGCTATTACCACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017580.1-1810s1c1
Sequence:CCGGGCTGGAAAGATTGGGAATCATCTCGAGATGATTCCCAATCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017580.1-1210s1c1
Sequence:CCGGCCATAGAAGCATACAAGTCATCTCGAGATGACTTGTATGCTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017580.1-1807s1c2
Sequence:CCGGCACGCTGGAAAGATTGGGAATCTCGAGATTCCCAATCTTTCCAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017580.2-592s21c2
Sequence:GTACCGGCAAGGGTGAAATCTTCGTATACTCGAGTATACGAAGATTTCACCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017580.2-1099s21c2
Sequence:CCGGAGGAACTTGAAGTAGACTTTACTCGAGTAAAGTCTACTTCAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017580.2-887s21c2
Sequence:GTACCGGTGATCATCCCAGACCTAATAACTCGAGTTATTAGGTCTGGGATGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017580.2-1964s21c2
Sequence:CCGGTATTCTTAGACGACCAATTATCTCGAGATAATTGGTCGTCTAAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017580.2-4226s21c2
Sequence:CCGGACTTAGCATCTGTAGTAATTTCTCGAGAAATTACTACAGATGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017580
VALIDATED
ZRANB1 MISSION shRNA shRNA Plasmid DNA
zinc finger, RAN-binding domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017580.1-2523s1c1
Sequence:CCGGCCAAGGCATCAGATCTGTAATCTCGAGATTACAGATCTGATGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017580.1-991s1c1
Sequence:CCGGGCAGTAGTGGTAATAGCCAAACTCGAGTTTGGCTATTACCACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017580.1-1810s1c1
Sequence:CCGGGCTGGAAAGATTGGGAATCATCTCGAGATGATTCCCAATCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017580.1-1210s1c1
Sequence:CCGGCCATAGAAGCATACAAGTCATCTCGAGATGACTTGTATGCTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017580.1-1807s1c2
Sequence:CCGGCACGCTGGAAAGATTGGGAATCTCGAGATTCCCAATCTTTCCAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017580.2-592s21c2
Sequence:GTACCGGCAAGGGTGAAATCTTCGTATACTCGAGTATACGAAGATTTCACCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017580.2-1099s21c2
Sequence:CCGGAGGAACTTGAAGTAGACTTTACTCGAGTAAAGTCTACTTCAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017580.2-887s21c2
Sequence:GTACCGGTGATCATCCCAGACCTAATAACTCGAGTTATTAGGTCTGGGATGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017580.2-1964s21c2
Sequence:CCGGTATTCTTAGACGACCAATTATCTCGAGATAATTGGTCGTCTAAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017580.2-4226s21c2
Sequence:CCGGACTTAGCATCTGTAGTAATTTCTCGAGAAATTACTACAGATGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017580
VALIDATED
ZRANB1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, RAN-binding domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073813    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017580.1-2523s1c1
Sequence:CCGGCCAAGGCATCAGATCTGTAATCTCGAGATTACAGATCTGATGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017580.1-991s1c1
Sequence:CCGGGCAGTAGTGGTAATAGCCAAACTCGAGTTTGGCTATTACCACTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017580.1-1810s1c1
Sequence:CCGGGCTGGAAAGATTGGGAATCATCTCGAGATGATTCCCAATCTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017580.1-1210s1c1
Sequence:CCGGCCATAGAAGCATACAAGTCATCTCGAGATGACTTGTATGCTTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017580.1-1807s1c2
Sequence:CCGGCACGCTGGAAAGATTGGGAATCTCGAGATTCCCAATCTTTCCAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017580.2-592s21c2
Sequence:GTACCGGCAAGGGTGAAATCTTCGTATACTCGAGTATACGAAGATTTCACCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017580.2-1099s21c2
Sequence:CCGGAGGAACTTGAAGTAGACTTTACTCGAGTAAAGTCTACTTCAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017580.2-887s21c2
Sequence:GTACCGGTGATCATCCCAGACCTAATAACTCGAGTTATTAGGTCTGGGATGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_017580.2-1964s21c2
Sequence:CCGGTATTCTTAGACGACCAATTATCTCGAGATAATTGGTCGTCTAAGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017580.2-4226s21c2
Sequence:CCGGACTTAGCATCTGTAGTAATTTCTCGAGAAATTACTACAGATGCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks