EMAIL THIS PAGE TO A FRIEND

ZRANB2

zinc finger, RAN-binding domain containing 2

Synonyms: ZIS ZIS1 ZIS2 ZNF265
Gene ID:
Mouse(53861) zinc finger, RAN-binding domain containing 2
Rat(58821) zinc finger, RAN-binding domain containing 2
Zebrafish(406716) zinc finger, RAN-binding domain containing 2
chicken(424717) zinc finger, RAN-binding domain containing 2
dog(490213) zinc finger, RAN-binding domain containing 2
domestic cat(101084378) zinc finger, RAN-binding domain containing 2
cow(508905) zinc finger, RAN-binding domain containing 2
sheep(101119088) zinc finger, RAN-binding domain containing 2
naked mole-rat(101716002) zinc finger, RAN-binding domain containing 2
domestic guinea pig(100717326) zinc finger, RAN-binding domain containing 2
179 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV37747 Anti-ZNF265 antibody produced in rabbit IgG fraction of antiserum , human, mouse, guinea pig, canine, pig, rabbit, bovine, zebrafish, rat, horse
western blot pricing
SAB4503633 Anti-ZNF265 antibody produced in rabbit affinity isolated antibody rat, mouse, human
pricing
SAB2102971 Anti-ZRANB2 (ab1) antibody produced in rabbit affinity isolated antibody human, guinea pig, rat, horse, canine, bovine, pig, mouse, rabbit
western blot pricing
SAB2102972 Anti-ZRANB2 (ab2) antibody produced in rabbit affinity isolated antibody canine, human, horse, bovine, rabbit, rat, guinea pig, pig, mouse
western blot pricing
AV35779 Anti-ZRANB2 antibody produced in rabbit affinity isolated antibody bovine, canine, human, horse, mouse, rat, pig, rabbit, guinea pig
immunohistochemistry, western blot pricing
HPA063298 Anti-ZRANB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA053960 Anti-ZRANB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA061949 Anti-ZRANB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0009406M1 Monoclonal Anti-ZNF265 antibody produced in mouse clone 1D10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1404714 Monoclonal Anti-ZNF265, (N-terminal) antibody produced in mouse clone 2A11, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017381 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017381 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017381 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005455 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005455 Rosetta Predictions human pricing
NM_203350 Rosetta Predictions human pricing
NM_031616 Rosetta Predictions rat pricing
NM_017381 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075842 predicted 1477
2 SASI_Hs01_00075843 predicted 1405
3 SASI_Hs01_00075844 predicted 245
4 SASI_Hs02_00339613 predicted 1271
5 SASI_Hs01_00075845 predicted 1343
6 SASI_Hs01_00075847 predicted 1334
7 SASI_Hs01_00075849 predicted 287
8 SASI_Hs01_00075850 predicted 182
9 SASI_Hs02_00339614 predicted 1097
10 SASI_Hs02_00339615 predicted 407
11 SASI_Hs01_00075846 predicted 1512
12 SASI_Hs01_00075848 predicted 766
13 SASI_Hs01_00075851 predicted 922
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151719 predicted 1443
2 SASI_Hs01_00151720 predicted 1404
3 SASI_Hs01_00151721 predicted 1330
4 SASI_Hs01_00151722 predicted 1538
5 SASI_Hs01_00151723 predicted 254
6 SASI_Hs01_00151724 predicted 249
7 SASI_Hs02_00373287 predicted 1501
8 SASI_Hs01_00151726 predicted 1280
9 SASI_Hs01_00151727 predicted 1540
10 SASI_Hs01_00151728 predicted 1415
11 SASI_Hs01_00151725 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031616 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110284 predicted 259
2 SASI_Rn01_00110285 predicted 193
3 SASI_Rn01_00110286 predicted 1033
4 SASI_Rn01_00110287 predicted 918
5 SASI_Rn01_00110289 predicted 286
6 SASI_Rn01_00110290 predicted 540
7 SASI_Rn01_00110291 predicted 969
8 SASI_Rn01_00110292 predicted 512
9 SASI_Rn01_00110293 predicted 211
10 SASI_Rn02_00264908 predicted 1036
11 SASI_Rn01_00110288 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046077 predicted 496
2 SASI_Mm01_00046078 predicted 266
3 SASI_Mm01_00046079 predicted 202
4 SASI_Mm01_00046080 predicted 211
5 SASI_Mm01_00046081 predicted 1039
6 SASI_Mm01_00046082 predicted 927
7 SASI_Mm01_00046083 predicted 510
8 SASI_Mm01_00046084 predicted 700
9 SASI_Mm01_00046085 predicted 289
10 SASI_Mm01_00046086 predicted 494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017381
VALIDATED
ZRANB2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, RAN-binding domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017381.2-81s21c1
Sequence:CCGGGTGGAAATGTAAACTTTGCTACTCGAGTAGCAAAGTTTACATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017381.2-582s21c1
Sequence:CCGGCCAGCGAAGAAGAAGATAGTACTCGAGTACTATCTTCTTCTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017381.2-1050s21c1
Sequence:CCGGTACAGTGCATGAAGCATATTTCTCGAGAAATATGCTTCATGCACTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017381.2-435s21c1
Sequence:CCGGCAGTTGGCCCTGCATCTATATCTCGAGATATAGATGCAGGGCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017381.2-392s21c1
Sequence:CCGGTATGATGAGTTTGGACGTAAACTCGAGTTTACGTCCAAACTCATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017381.1-2411s1c1
Sequence:CCGGCCAACGTGTTAGCCTTGGTTTCTCGAGAAACCAAGGCTAACACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017381.1-583s1c1
Sequence:CCGGCCAGCGAAGAAGAAGATAGTACTCGAGTACTATCTTCTTCTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017381.1-82s1c1
Sequence:CCGGGTGGAAATGTAAACTTTGCTACTCGAGTAGCAAAGTTTACATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017381.1-976s1c1
Sequence:CCGGCAACACATTCTGGTTCCCGTTCTCGAGAACGGGAACCAGAATGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017381.1-208s1c1
Sequence:CCGGGCTTATTTAGTGCCAATGATTCTCGAGAATCATTGGCACTAAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017381
VALIDATED
ZRANB2 MISSION shRNA shRNA Plasmid DNA
zinc finger, RAN-binding domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017381.2-81s21c1
Sequence:CCGGGTGGAAATGTAAACTTTGCTACTCGAGTAGCAAAGTTTACATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017381.2-582s21c1
Sequence:CCGGCCAGCGAAGAAGAAGATAGTACTCGAGTACTATCTTCTTCTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017381.2-1050s21c1
Sequence:CCGGTACAGTGCATGAAGCATATTTCTCGAGAAATATGCTTCATGCACTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017381.2-435s21c1
Sequence:CCGGCAGTTGGCCCTGCATCTATATCTCGAGATATAGATGCAGGGCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017381.2-392s21c1
Sequence:CCGGTATGATGAGTTTGGACGTAAACTCGAGTTTACGTCCAAACTCATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017381.1-2411s1c1
Sequence:CCGGCCAACGTGTTAGCCTTGGTTTCTCGAGAAACCAAGGCTAACACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017381.1-583s1c1
Sequence:CCGGCCAGCGAAGAAGAAGATAGTACTCGAGTACTATCTTCTTCTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017381.1-82s1c1
Sequence:CCGGGTGGAAATGTAAACTTTGCTACTCGAGTAGCAAAGTTTACATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017381.1-976s1c1
Sequence:CCGGCAACACATTCTGGTTCCCGTTCTCGAGAACGGGAACCAGAATGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017381.1-208s1c1
Sequence:CCGGGCTTATTTAGTGCCAATGATTCTCGAGAATCATTGGCACTAAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017381
VALIDATED
ZRANB2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, RAN-binding domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017381.2-81s21c1
Sequence:CCGGGTGGAAATGTAAACTTTGCTACTCGAGTAGCAAAGTTTACATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017381.2-582s21c1
Sequence:CCGGCCAGCGAAGAAGAAGATAGTACTCGAGTACTATCTTCTTCTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295439    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017381.2-1050s21c1
Sequence:CCGGTACAGTGCATGAAGCATATTTCTCGAGAAATATGCTTCATGCACTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_017381.2-435s21c1
Sequence:CCGGCAGTTGGCCCTGCATCTATATCTCGAGATATAGATGCAGGGCCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017381.2-392s21c1
Sequence:CCGGTATGATGAGTTTGGACGTAAACTCGAGTTTACGTCCAAACTCATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126934    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017381.1-2411s1c1
Sequence:CCGGCCAACGTGTTAGCCTTGGTTTCTCGAGAAACCAAGGCTAACACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017381.1-583s1c1
Sequence:CCGGCCAGCGAAGAAGAAGATAGTACTCGAGTACTATCTTCTTCTTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_017381.1-82s1c1
Sequence:CCGGGTGGAAATGTAAACTTTGCTACTCGAGTAGCAAAGTTTACATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017381.1-976s1c1
Sequence:CCGGCAACACATTCTGGTTCCCGTTCTCGAGAACGGGAACCAGAATGTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017381.1-208s1c1
Sequence:CCGGGCTTATTTAGTGCCAATGATTCTCGAGAATCATTGGCACTAAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005455
VALIDATED
ZRANB2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, RAN-binding domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005455.3-1046s21c1
Sequence:CCGGCTACGGAACACCACTACTTTACTCGAGTAAAGTAGTGGTGTTCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005455.3-480s21c1
Sequence:CCGGCAGTTGGTCCTGCATCTATATCTCGAGATATAGATGCAGGACCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005455.3-437s21c1
Sequence:CCGGTATGATGAGTTTGGACGTAAACTCGAGTTTACGTCCAAACTCATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005455.3-334s21c1
Sequence:CCGGTACTCCAAAGTATGCTAAATTCTCGAGAATTTAGCATACTTTGGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005455.3-1621s1c1
Sequence:CCGGGCCAACTGTAAATGTCTATTTCTCGAGAAATAGACATTTACAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005455.3-306s1c1
Sequence:CCGGCCAGAAGATCAGAGTGTAATACTCGAGTATTACACTCTGATCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005455.3-248s1c1
Sequence:CCGGCGAGGCCTATTTAGTGCTAATCTCGAGATTAGCACTAAATAGGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_005455.3-690s1c1
Sequence:CCGGCTTCACATTCACGATCTTCATCTCGAGATGAAGATCGTGAATGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005455.3-488s1c1
Sequence:CCGGCCTGCATCTATATTAAAGGAACTCGAGTTCCTTTAATATAGATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005455
VALIDATED
ZRANB2 MISSION shRNA shRNA Plasmid DNA
zinc finger, RAN-binding domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005455.3-1046s21c1
Sequence:CCGGCTACGGAACACCACTACTTTACTCGAGTAAAGTAGTGGTGTTCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005455.3-480s21c1
Sequence:CCGGCAGTTGGTCCTGCATCTATATCTCGAGATATAGATGCAGGACCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005455.3-437s21c1
Sequence:CCGGTATGATGAGTTTGGACGTAAACTCGAGTTTACGTCCAAACTCATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005455.3-334s21c1
Sequence:CCGGTACTCCAAAGTATGCTAAATTCTCGAGAATTTAGCATACTTTGGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005455.3-1621s1c1
Sequence:CCGGGCCAACTGTAAATGTCTATTTCTCGAGAAATAGACATTTACAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005455.3-306s1c1
Sequence:CCGGCCAGAAGATCAGAGTGTAATACTCGAGTATTACACTCTGATCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005455.3-248s1c1
Sequence:CCGGCGAGGCCTATTTAGTGCTAATCTCGAGATTAGCACTAAATAGGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_005455.3-690s1c1
Sequence:CCGGCTTCACATTCACGATCTTCATCTCGAGATGAAGATCGTGAATGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005455.3-488s1c1
Sequence:CCGGCCTGCATCTATATTAAAGGAACTCGAGTTCCTTTAATATAGATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005455
VALIDATED
ZRANB2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, RAN-binding domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232204    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005455.3-1046s21c1
Sequence:CCGGCTACGGAACACCACTACTTTACTCGAGTAAAGTAGTGGTGTTCCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005455.3-480s21c1
Sequence:CCGGCAGTTGGTCCTGCATCTATATCTCGAGATATAGATGCAGGACCAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005455.3-437s21c1
Sequence:CCGGTATGATGAGTTTGGACGTAAACTCGAGTTTACGTCCAAACTCATCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005455.3-334s21c1
Sequence:CCGGTACTCCAAAGTATGCTAAATTCTCGAGAATTTAGCATACTTTGGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005455.3-1621s1c1
Sequence:CCGGGCCAACTGTAAATGTCTATTTCTCGAGAAATAGACATTTACAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005455.3-306s1c1
Sequence:CCGGCCAGAAGATCAGAGTGTAATACTCGAGTATTACACTCTGATCTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005455.3-248s1c1
Sequence:CCGGCGAGGCCTATTTAGTGCTAATCTCGAGATTAGCACTAAATAGGCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_005455.3-690s1c1
Sequence:CCGGCTTCACATTCACGATCTTCATCTCGAGATGAAGATCGTGAATGTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005455.3-488s1c1
Sequence:CCGGCCTGCATCTATATTAAAGGAACTCGAGTTCCTTTAATATAGATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks