EMAIL THIS PAGE TO A FRIEND

ZRANB3

zinc finger, RAN-binding domain containing 3

Synonyms: 4933425L19Rik AH2
Gene ID:
Mouse(226409) zinc finger, RAN-binding domain containing 3
Rat(304761) zinc finger, RAN-binding domain containing 3
Zebrafish(553237) zinc finger, RAN-binding domain containing 3
chicken(424291) zinc finger, RAN-binding domain containing 3
Horse(100050746) zinc finger, RAN-binding domain containing 3
domestic cat(101093202) zinc finger, RAN-binding domain containing 3
dog(476128) zinc finger, RAN-binding domain containing 3
domestic guinea pig(100732438) zinc finger, RAN-binding domain containing 3
naked mole-rat(101726197) zinc finger, RAN-binding domain containing 3
Domestic Rabbit(100350819) zinc finger, RAN-binding domain containing 3
cow(529922) zinc finger, RAN-binding domain containing 3
sheep(101104967) zinc finger, RAN-binding domain containing 3
126 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032143 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032143 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032143 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027678 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027678 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027678 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032143 Rosetta Predictions human pricing
XM_222621 Rosetta Predictions rat pricing
XR_007587 Rosetta Predictions rat pricing
NM_027678 Rosetta Predictions mouse pricing
XM_129483 Rosetta Predictions mouse pricing
XM_885707 Rosetta Predictions mouse pricing
XM_896374 Rosetta Predictions mouse pricing
XM_896396 Rosetta Predictions mouse pricing
XM_896419 Rosetta Predictions mouse pricing
XM_896436 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109802 predicted 2006
2 SASI_Hs01_00109803 predicted 1204
3 SASI_Hs01_00109804 predicted 2081
4 SASI_Hs01_00109805 predicted 496
5 SASI_Hs01_00109806 predicted 348
6 SASI_Hs02_00359374 predicted 3101
7 SASI_Hs01_00109807 predicted 2943
8 SASI_Hs01_00109808 predicted 466
9 SASI_Hs01_00109809 predicted 1845
10 SASI_Hs02_00359375 predicted 2251
11 SASI_Hs01_00109810 predicted 1448
12 SASI_Hs01_00109811 predicted 1318
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00124883 predicted 1364
2 SASI_Rn01_00124884 predicted 2599
3 SASI_Rn01_00124885 predicted 1348
4 SASI_Rn01_00124886 predicted 1046
5 SASI_Rn01_00124887 predicted 2427
6 SASI_Rn01_00124888 predicted 1890
7 SASI_Rn01_00124889 predicted 1627
8 SASI_Rn01_00124890 predicted 2559
9 SASI_Rn01_00124891 predicted 3175
10 SASI_Rn01_00124892 predicted 2021
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00414969 predicted 4154
2 SASI_Rn01_00176850 predicted 1809
3 SASI_Rn02_00414970 predicted 4204
4 SASI_Rn02_00414971 predicted 4399
5 SASI_Rn01_00176851 predicted 1457
6 SASI_Rn01_00176853 predicted 1560
7 SASI_Rn01_00176854 predicted 1467
8 SASI_Rn01_00176855 predicted 2093
9 SASI_Rn01_00176856 predicted 3180
10 SASI_Rn01_00176857 predicted 2361
11 SASI_Rn01_00176852 predicted 1278
12 SASI_Rn01_00176858 predicted 961
13 SASI_Rn01_00176859 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332567 predicted 1247
2 SASI_Mm02_00332568 predicted 352
3 SASI_Mm02_00332569 predicted 2305
4 SASI_Mm02_00332570 predicted 1045
5 SASI_Mm02_00332571 predicted 2954
6 SASI_Mm02_00332572 predicted 2821
7 SASI_Mm02_00332573 predicted 813
8 SASI_Mm02_00332574 predicted 1769
9 SASI_Mm02_00332575 predicted 903
10 SASI_Mm02_00332576 predicted 1489
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129483 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254240 predicted 1177
2 SASI_Mm01_00254241 predicted 276
3 SASI_Mm01_00254242 predicted 3341
4 SASI_Mm01_00254243 predicted 965
5 SASI_Mm01_00254244 predicted 2877
6 SASI_Mm01_00254245 predicted 2747
7 SASI_Mm01_00254246 predicted 740
8 SASI_Mm01_00254247 predicted 1693
9 SASI_Mm01_00254248 predicted 828
10 SASI_Mm01_00254249 predicted 1413
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_885707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284770 predicted 1730
2 SASI_Mm01_00284771 predicted 835
3 SASI_Mm01_00284772 predicted 3900
4 SASI_Mm01_00284773 predicted 1532
5 SASI_Mm01_00284774 predicted 3441
6 SASI_Mm01_00284775 predicted 3316
7 SASI_Mm01_00284776 predicted 1309
8 SASI_Mm01_00284777 predicted 2257
9 SASI_Mm01_00284778 predicted 1382
10 SASI_Mm01_00284779 predicted 1977
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226580 predicted 1306
2 SASI_Mm01_00226581 predicted 407
3 SASI_Mm01_00226582 predicted 3471
4 SASI_Mm01_00226583 predicted 1103
5 SASI_Mm01_00226584 predicted 3013
6 SASI_Mm01_00226585 predicted 2885
7 SASI_Mm01_00226586 predicted 880
8 SASI_Mm01_00226587 predicted 1826
9 SASI_Mm01_00226588 predicted 963
10 SASI_Mm01_00226589 predicted 1551
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896396 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224110 predicted 294
2 SASI_Mm01_00224111 predicted 1177
3 SASI_Mm01_00224112 predicted 368
4 SASI_Mm01_00224113 predicted 279
5 SASI_Mm01_00224114 predicted 965
6 SASI_Mm01_00224115 predicted 744
7 SASI_Mm01_00224116 predicted 1297
8 SASI_Mm01_00224117 predicted 833
9 SASI_Mm01_00224118 predicted 339
10 SASI_Mm01_00224119 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260498 predicted 1249
2 SASI_Mm01_00260499 predicted 2310
3 SASI_Mm01_00260500 predicted 3426
4 SASI_Mm01_00260501 predicted 1044
5 SASI_Mm01_00260502 predicted 2956
6 SASI_Mm01_00260503 predicted 2832
7 SASI_Mm01_00260504 predicted 821
8 SASI_Mm01_00260505 predicted 1783
9 SASI_Mm01_00260506 predicted 912
10 SASI_Mm01_00260507 predicted 1492
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210326 predicted 1300
2 SASI_Mm01_00210327 predicted 415
3 SASI_Mm01_00210328 predicted 3483
4 SASI_Mm01_00210329 predicted 1095
5 SASI_Mm01_00210330 predicted 3020
6 SASI_Mm01_00210331 predicted 2900
7 SASI_Mm01_00210332 predicted 872
8 SASI_Mm01_00210333 predicted 1835
9 SASI_Mm01_00210334 predicted 958
10 SASI_Mm01_00210335 predicted 1541
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032143
VALIDATED
ZRANB3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, RAN-binding domain containing 3
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032143.1-434s1c1
Sequence:CCGGGCAATGTAGTCTCTGCACCTACTCGAGTAGGTGCAGAGACTACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_032143.1-873s1c1
Sequence:CCGGGCAAGCTTTCAGCTGAAACAACTCGAGTTGTTTCAGCTGAAAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032143.1-483s1c1
Sequence:CCGGGAAATGTGTGAGACTCCTCAACTCGAGTTGAGGAGTCTCACACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032143.1-1782s1c1
Sequence:CCGGGAAACCTCAAAGCTGCATGAACTCGAGTTCATGCAGCTTTGAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032143.1-737s1c1
Sequence:CCGGGCCAGTGTATGACACCTTAATCTCGAGATTAAGGTGTCATACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032143.1-1732s1c1
Sequence:CCGGGAAGACAATCTCTAGCATCAACTCGAGTTGATGCTAGAGATTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032143.1-751s1c1
Sequence:CCGGCCTTAATGTTCTGTGCAAGTACTCGAGTACTTGCACAGAACATTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032143.2-1118s21c1
Sequence:CCGGTTCAGAATGATTCGCTTAAATCTCGAGATTTAAGCGAATCATTCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032143.2-1436s21c1
Sequence:CCGGTGAATATTCACTACCTTATTGCTCGAGCAATAAGGTAGTGAATATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032143.2-3427s21c1
Sequence:CCGGGTTTGTTTAATATATCGAGAGCTCGAGCTCTCGATATATTAAACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032143.2-2800s21c1
Sequence:CCGGTCTACATCCAAAGGCTATTTGCTCGAGCAAATAGCCTTTGGATGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032143.2-3532s21c1
Sequence:CCGGACAGAAACTAAGATACAATACCTCGAGGTATTGTATCTTAGTTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032143.2-1799s21c1
Sequence:CCGGCAAGAGATATCATCGATTATGCTCGAGCATAATCGATGATATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032143.2-3391s21c1
Sequence:CCGGTTACATGTGGAAGACTTTAATCTCGAGATTAAAGTCTTCCACATGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032143.2-1494s21c1
Sequence:CCGGGAATCGCAAGGCTCAAGTTACCTCGAGGTAACTTGAGCCTTGCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032143.2-1043s21c1
Sequence:CCGGGGTTGATAACTCGCATGTTTACTCGAGTAAACATGCGAGTTATCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032143
VALIDATED
ZRANB3 MISSION shRNA shRNA Plasmid DNA
zinc finger, RAN-binding domain containing 3
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032143.1-434s1c1
Sequence:CCGGGCAATGTAGTCTCTGCACCTACTCGAGTAGGTGCAGAGACTACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_032143.1-873s1c1
Sequence:CCGGGCAAGCTTTCAGCTGAAACAACTCGAGTTGTTTCAGCTGAAAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032143.1-483s1c1
Sequence:CCGGGAAATGTGTGAGACTCCTCAACTCGAGTTGAGGAGTCTCACACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032143.1-1782s1c1
Sequence:CCGGGAAACCTCAAAGCTGCATGAACTCGAGTTCATGCAGCTTTGAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032143.1-737s1c1
Sequence:CCGGGCCAGTGTATGACACCTTAATCTCGAGATTAAGGTGTCATACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032143.1-1732s1c1
Sequence:CCGGGAAGACAATCTCTAGCATCAACTCGAGTTGATGCTAGAGATTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032143.1-751s1c1
Sequence:CCGGCCTTAATGTTCTGTGCAAGTACTCGAGTACTTGCACAGAACATTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032143.2-1118s21c1
Sequence:CCGGTTCAGAATGATTCGCTTAAATCTCGAGATTTAAGCGAATCATTCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032143.2-1436s21c1
Sequence:CCGGTGAATATTCACTACCTTATTGCTCGAGCAATAAGGTAGTGAATATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032143.2-3427s21c1
Sequence:CCGGGTTTGTTTAATATATCGAGAGCTCGAGCTCTCGATATATTAAACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032143.2-2800s21c1
Sequence:CCGGTCTACATCCAAAGGCTATTTGCTCGAGCAAATAGCCTTTGGATGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032143.2-3532s21c1
Sequence:CCGGACAGAAACTAAGATACAATACCTCGAGGTATTGTATCTTAGTTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032143.2-1799s21c1
Sequence:CCGGCAAGAGATATCATCGATTATGCTCGAGCATAATCGATGATATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032143.2-3391s21c1
Sequence:CCGGTTACATGTGGAAGACTTTAATCTCGAGATTAAAGTCTTCCACATGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032143.2-1494s21c1
Sequence:CCGGGAATCGCAAGGCTCAAGTTACCTCGAGGTAACTTGAGCCTTGCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032143.2-1043s21c1
Sequence:CCGGGGTTGATAACTCGCATGTTTACTCGAGTAAACATGCGAGTTATCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032143
VALIDATED
ZRANB3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, RAN-binding domain containing 3
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032143.1-434s1c1
Sequence:CCGGGCAATGTAGTCTCTGCACCTACTCGAGTAGGTGCAGAGACTACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_032143.1-873s1c1
Sequence:CCGGGCAAGCTTTCAGCTGAAACAACTCGAGTTGTTTCAGCTGAAAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032143.1-483s1c1
Sequence:CCGGGAAATGTGTGAGACTCCTCAACTCGAGTTGAGGAGTCTCACACATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032143.1-1782s1c1
Sequence:CCGGGAAACCTCAAAGCTGCATGAACTCGAGTTCATGCAGCTTTGAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_032143.1-737s1c1
Sequence:CCGGGCCAGTGTATGACACCTTAATCTCGAGATTAAGGTGTCATACACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032143.1-1732s1c1
Sequence:CCGGGAAGACAATCTCTAGCATCAACTCGAGTTGATGCTAGAGATTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032143.1-751s1c1
Sequence:CCGGCCTTAATGTTCTGTGCAAGTACTCGAGTACTTGCACAGAACATTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032143.2-1118s21c1
Sequence:CCGGTTCAGAATGATTCGCTTAAATCTCGAGATTTAAGCGAATCATTCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032143.2-1436s21c1
Sequence:CCGGTGAATATTCACTACCTTATTGCTCGAGCAATAAGGTAGTGAATATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032143.2-3427s21c1
Sequence:CCGGGTTTGTTTAATATATCGAGAGCTCGAGCTCTCGATATATTAAACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032143.2-2800s21c1
Sequence:CCGGTCTACATCCAAAGGCTATTTGCTCGAGCAAATAGCCTTTGGATGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032143.2-3532s21c1
Sequence:CCGGACAGAAACTAAGATACAATACCTCGAGGTATTGTATCTTAGTTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032143.2-1799s21c1
Sequence:CCGGCAAGAGATATCATCGATTATGCTCGAGCATAATCGATGATATCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032143.2-3391s21c1
Sequence:CCGGTTACATGTGGAAGACTTTAATCTCGAGATTAAAGTCTTCCACATGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032143.2-1494s21c1
Sequence:CCGGGAATCGCAAGGCTCAAGTTACCTCGAGGTAACTTGAGCCTTGCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032143.2-1043s21c1
Sequence:CCGGGGTTGATAACTCGCATGTTTACTCGAGTAAACATGCGAGTTATCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027678
VALIDATED
ZRANB3 MISSION shRNA Bacterial Glycerol Stock
zinc finger, RAN-binding domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027678.2-1187s21c1
Sequence:CCGGCTGGTCTTTGCGCACCATTTACTCGAGTAAATGGTGCGCAAAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027678.2-1482s21c1
Sequence:CCGGTGAATATTCACTACCTTATTGCTCGAGCAATAAGGTAGTGAATATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027678.2-1133s21c1
Sequence:CCGGGGTGCAGTGAAGGACTATATTCTCGAGAATATAGTCCTTCACTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027678.2-3714s21c1
Sequence:CCGGTTCTGGACTGTGTAGTATAAACTCGAGTTTATACTACACAGTCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027678.2-3363s21c1
Sequence:CCGGTGAAGAAGTAAGGCGAGATATCTCGAGATATCTCGCCTTACTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027678
VALIDATED
ZRANB3 MISSION shRNA shRNA Plasmid DNA
zinc finger, RAN-binding domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027678.2-1187s21c1
Sequence:CCGGCTGGTCTTTGCGCACCATTTACTCGAGTAAATGGTGCGCAAAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027678.2-1482s21c1
Sequence:CCGGTGAATATTCACTACCTTATTGCTCGAGCAATAAGGTAGTGAATATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027678.2-1133s21c1
Sequence:CCGGGGTGCAGTGAAGGACTATATTCTCGAGAATATAGTCCTTCACTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027678.2-3714s21c1
Sequence:CCGGTTCTGGACTGTGTAGTATAAACTCGAGTTTATACTACACAGTCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027678.2-3363s21c1
Sequence:CCGGTGAAGAAGTAAGGCGAGATATCTCGAGATATCTCGCCTTACTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027678
VALIDATED
ZRANB3 MISSION shRNA Lentiviral Transduction Particles
zinc finger, RAN-binding domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027678.2-1187s21c1
Sequence:CCGGCTGGTCTTTGCGCACCATTTACTCGAGTAAATGGTGCGCAAAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027678.2-1482s21c1
Sequence:CCGGTGAATATTCACTACCTTATTGCTCGAGCAATAAGGTAGTGAATATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027678.2-1133s21c1
Sequence:CCGGGGTGCAGTGAAGGACTATATTCTCGAGAATATAGTCCTTCACTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239046    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027678.2-3714s21c1
Sequence:CCGGTTCTGGACTGTGTAGTATAAACTCGAGTTTATACTACACAGTCCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027678.2-3363s21c1
Sequence:CCGGTGAAGAAGTAAGGCGAGATATCTCGAGATATCTCGCCTTACTTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks