EMAIL THIS PAGE TO A FRIEND

ZRSR1

zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 1

Synonyms: U2AF1-RS1 U2AF1L1 U2AF1P U2AF1RS1 U2AFBPL
UniProtKB ID: Q15695, B2R901, Q13570, Q2M3R8
Gene ID:
Mouse(22183) zinc finger (CCCH type), RNA binding motif and serine/arginine rich 1
Rat(498425) zinc finger (CCCH type), RNA binding motif and serine/arginine rich 1
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011663 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011663 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011663 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU220481 MISSION® esiRNA esiRNA targeting human ZRSR1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017504 Rosetta Predictions rat pricing
NM_011663 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030667 predicted 1329
2 SASI_Rn01_00030668 predicted 1484
3 SASI_Rn01_00030669 predicted 925
4 SASI_Rn01_00030670 predicted 1447
5 SASI_Rn02_00202328 predicted 767
6 SASI_Rn01_00030674 predicted 1428
7 SASI_Rn01_00030675 predicted 1373
8 SASI_Rn02_00202329 predicted 667
9 SASI_Rn02_00202330 predicted 1109
10 SASI_Rn02_00202331 predicted 776
11 SASI_Rn01_00030671 predicted 1493
12 SASI_Rn01_00030672 predicted 1464
13 SASI_Rn01_00030673 predicted 891
14 SASI_Rn01_00030676 predicted 1216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011663 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145816 predicted 2511
2 SASI_Mm01_00145817 predicted 2140
3 SASI_Mm01_00145819 predicted 2377
4 SASI_Mm01_00145820 predicted 2161
5 SASI_Mm01_00145821 predicted 2284
6 SASI_Mm01_00145822 predicted 2266
7 SASI_Mm01_00145823 predicted 2091
8 SASI_Mm02_00321169 predicted 2285
9 SASI_Mm02_00321170 predicted 2273
10 SASI_Mm01_00145824 predicted 2316
11 SASI_Mm01_00145818 predicted 2185
12 SASI_Mm01_00145825 predicted 1809
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011663
VALIDATED
ZRSR1 MISSION shRNA Bacterial Glycerol Stock
zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011663.2-2625s21c1
Sequence:CCGGCGAAACTGATTACAAAGGAAACTCGAGTTTCCTTTGTAATCAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011663.2-1810s21c1
Sequence:CCGGAGTGCAGAAGGGATGACTATGCTCGAGCATAGTCATCCCTTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011663.2-1683s21c1
Sequence:CCGGAGTTGTCCCTTCTACAATAAACTCGAGTTTATTGTAGAAGGGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011663.2-1732s21c1
Sequence:CCGGGTTCACGGAAACACGACTTTCCTCGAGGAAAGTCGTGTTTCCGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011663.2-2085s21c1
Sequence:CCGGACCCGGTGGAAGGTTGCAATTCTCGAGAATTGCAACCTTCCACCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011663.1-2612s1c1
Sequence:CCGGCGAAACTGATTACAAAGGAAACTCGAGTTTCCTTTGTAATCAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011663.1-1752s1c1
Sequence:CCGGCCACCCTTCTTGTGAAGAGTACTCGAGTACTCTTCACAAGAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011663.1-1352s1c1
Sequence:CCGGGCAGAGCGATTACTGGAGATACTCGAGTATCTCCAGTAATCGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011663.1-1757s1c1
Sequence:CCGGCTTCTTGTGAAGAGTATGTTTCTCGAGAAACATACTCTTCACAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011663.1-2162s1c1
Sequence:CCGGCCCAACAACGAATTTAGAGAACTCGAGTTCTCTAAATTCGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011663
VALIDATED
ZRSR1 MISSION shRNA shRNA Plasmid DNA
zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011663.2-2625s21c1
Sequence:CCGGCGAAACTGATTACAAAGGAAACTCGAGTTTCCTTTGTAATCAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011663.2-1810s21c1
Sequence:CCGGAGTGCAGAAGGGATGACTATGCTCGAGCATAGTCATCCCTTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011663.2-1683s21c1
Sequence:CCGGAGTTGTCCCTTCTACAATAAACTCGAGTTTATTGTAGAAGGGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011663.2-1732s21c1
Sequence:CCGGGTTCACGGAAACACGACTTTCCTCGAGGAAAGTCGTGTTTCCGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011663.2-2085s21c1
Sequence:CCGGACCCGGTGGAAGGTTGCAATTCTCGAGAATTGCAACCTTCCACCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011663.1-2612s1c1
Sequence:CCGGCGAAACTGATTACAAAGGAAACTCGAGTTTCCTTTGTAATCAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011663.1-1752s1c1
Sequence:CCGGCCACCCTTCTTGTGAAGAGTACTCGAGTACTCTTCACAAGAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011663.1-1352s1c1
Sequence:CCGGGCAGAGCGATTACTGGAGATACTCGAGTATCTCCAGTAATCGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011663.1-1757s1c1
Sequence:CCGGCTTCTTGTGAAGAGTATGTTTCTCGAGAAACATACTCTTCACAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011663.1-2162s1c1
Sequence:CCGGCCCAACAACGAATTTAGAGAACTCGAGTTCTCTAAATTCGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011663
VALIDATED
ZRSR1 MISSION shRNA Lentiviral Transduction Particles
zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011663.2-2625s21c1
Sequence:CCGGCGAAACTGATTACAAAGGAAACTCGAGTTTCCTTTGTAATCAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011663.2-1810s21c1
Sequence:CCGGAGTGCAGAAGGGATGACTATGCTCGAGCATAGTCATCCCTTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011663.2-1683s21c1
Sequence:CCGGAGTTGTCCCTTCTACAATAAACTCGAGTTTATTGTAGAAGGGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011663.2-1732s21c1
Sequence:CCGGGTTCACGGAAACACGACTTTCCTCGAGGAAAGTCGTGTTTCCGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011663.2-2085s21c1
Sequence:CCGGACCCGGTGGAAGGTTGCAATTCTCGAGAATTGCAACCTTCCACCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123559    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011663.1-2612s1c1
Sequence:CCGGCGAAACTGATTACAAAGGAAACTCGAGTTTCCTTTGTAATCAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011663.1-1752s1c1
Sequence:CCGGCCACCCTTCTTGTGAAGAGTACTCGAGTACTCTTCACAAGAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011663.1-1352s1c1
Sequence:CCGGGCAGAGCGATTACTGGAGATACTCGAGTATCTCCAGTAATCGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011663.1-1757s1c1
Sequence:CCGGCTTCTTGTGAAGAGTATGTTTCTCGAGAAACATACTCTTCACAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011663.1-2162s1c1
Sequence:CCGGCCCAACAACGAATTTAGAGAACTCGAGTTCTCTAAATTCGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks