EMAIL THIS PAGE TO A FRIEND

ZRSR2

zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2

Synonyms: U2AF1-RS2 U2AF1L2 U2AF1RS2 URP
UniProtKB ID: Q15696, Q14D69
Gene ID:
Human(8233) Summary: This gene encodes an essential splicing factor. The encoded protein associates with the U2 auxiliary factor heterodimer, which is required for the recognition of a functional 3' splice site in pre-mRNA splicing, and may play a role in network interactions during spliceosome assembly. [provided by RefSeq, Jul 2008]
Mouse(22184) zinc finger (CCCH type), RNA binding motif and serine/arginine rich 2
Rat(302670) zinc finger (CCCH type), RNA binding motif and serine/arginine rich 2
Zebrafish(100005490) zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2
chicken(428002) zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2
domestic cat(101086039) zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2
Horse(100056195) zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2
dog(491752) zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2
domestic guinea pig(100732528) zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2
naked mole-rat(101701353) zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2
cow(535064) zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2
sheep(101101870) zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40573 Anti-ZRSR2 antibody produced in rabbit IgG fraction of antiserum mouse, guinea pig, horse, canine, human, rat, rabbit
immunohistochemistry, western blot pricing
SAB2104500 Anti-ZRSR2, (N-terminal) antibody produced in rabbit affinity isolated antibody horse, rat, human, rabbit, mouse, zebrafish
western blot pricing
SAB1402980 Monoclonal Anti-U2AF1L2 antibody produced in mouse clone 2H5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178794 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178794 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178794 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005089 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU060951 MISSION® esiRNA esiRNA targeting mouse Zrsr2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005089 Rosetta Predictions human pricing
XM_001067753 Rosetta Predictions rat pricing
XM_217612 Rosetta Predictions rat pricing
NM_009453 Rosetta Predictions mouse pricing
NM_178794 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338940 predicted 812
2 SASI_Hs02_00338941 predicted 1062
3 SASI_Hs02_00338942 predicted 1076
4 SASI_Hs02_00338943 predicted 963
5 SASI_Hs02_00338944 predicted 647
6 SASI_Hs02_00338945 predicted 744
7 SASI_Hs02_00338946 predicted 1025
8 SASI_Hs02_00338947 predicted 1047
9 SASI_Hs02_00338948 predicted 1030
10 SASI_Hs02_00338949 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322158 predicted 1026
2 SASI_Rn02_00322159 predicted 1296
3 SASI_Rn02_00322160 predicted 1128
4 SASI_Rn02_00322161 predicted 392
5 SASI_Rn02_00322162 predicted 971
6 SASI_Rn02_00322163 predicted 1066
7 SASI_Rn02_00322164 predicted 1119
8 SASI_Rn02_00322165 predicted 1391
9 SASI_Rn02_00322166 predicted 436
10 SASI_Rn02_00322167 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377255 predicted 1032
2 SASI_Rn02_00377256 predicted 1300
3 SASI_Rn02_00377257 predicted 1134
4 SASI_Rn02_00377258 predicted 395
5 SASI_Rn02_00377259 predicted 971
6 SASI_Rn02_00377260 predicted 1062
7 SASI_Rn02_00377261 predicted 1125
8 SASI_Rn02_00377262 predicted 1396
9 SASI_Rn02_00377263 predicted 436
10 SASI_Rn02_00377264 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009453 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111854 predicted 827
2 SASI_Mm01_00111855 predicted 944
3 SASI_Mm01_00111856 predicted 1031
4 SASI_Mm01_00111857 predicted 1385
5 SASI_Mm02_00316158 predicted 1952
6 SASI_Mm02_00316159 predicted 1962
7 SASI_Mm01_00111858 predicted 1211
8 SASI_Mm02_00316160 predicted 1933
9 SASI_Mm01_00111859 predicted 344
10 SASI_Mm01_00111862 predicted 1284
11 SASI_Mm01_00111860 predicted 971
12 SASI_Mm01_00111861 predicted 1491
13 SASI_Mm01_00111863 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193062 predicted 797
2 SASI_Mm01_00193063 predicted 838
3 SASI_Mm01_00193064 predicted 768
4 SASI_Mm02_00349392 predicted 911
5 SASI_Mm01_00193066 predicted 920
6 SASI_Mm01_00193067 predicted 847
7 SASI_Mm02_00349393 predicted 348
8 SASI_Mm01_00193069 predicted 834
9 SASI_Mm01_00193070 predicted 918
10 SASI_Mm02_00349394 predicted 754
11 SASI_Mm01_00193061 predicted 926
12 SASI_Mm01_00193065 predicted 1053
13 SASI_Mm01_00193068 predicted 1228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178794
ZRSR2 MISSION shRNA Bacterial Glycerol Stock
zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178794.2-3529s1c1
Sequence:CCGGCGAGAGATACTTACCAAGTAACTCGAGTTACTTGGTAAGTATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178794.2-585s1c1
Sequence:CCGGGAAGAACTAGAGAGAAAGTTACTCGAGTAACTTTCTCTCTAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178794.2-898s1c1
Sequence:CCGGTGGTGCAATGACAGATACCTTCTCGAGAAGGTATCTGTCATTGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178794.2-861s1c1
Sequence:CCGGTGGAAACACTAGTTTCCAAATCTCGAGATTTGGAAACTAGTGTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178794.2-915s1c1
Sequence:CCGGCCTTTACCCTAAGTAAGTTATCTCGAGATAACTTACTTAGGGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178794
ZRSR2 MISSION shRNA shRNA Plasmid DNA
zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178794.2-3529s1c1
Sequence:CCGGCGAGAGATACTTACCAAGTAACTCGAGTTACTTGGTAAGTATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178794.2-585s1c1
Sequence:CCGGGAAGAACTAGAGAGAAAGTTACTCGAGTAACTTTCTCTCTAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178794.2-898s1c1
Sequence:CCGGTGGTGCAATGACAGATACCTTCTCGAGAAGGTATCTGTCATTGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178794.2-861s1c1
Sequence:CCGGTGGAAACACTAGTTTCCAAATCTCGAGATTTGGAAACTAGTGTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178794.2-915s1c1
Sequence:CCGGCCTTTACCCTAAGTAAGTTATCTCGAGATAACTTACTTAGGGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178794
ZRSR2 MISSION shRNA Lentiviral Transduction Particles
zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126324    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178794.2-3529s1c1
Sequence:CCGGCGAGAGATACTTACCAAGTAACTCGAGTTACTTGGTAAGTATCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178794.2-585s1c1
Sequence:CCGGGAAGAACTAGAGAGAAAGTTACTCGAGTAACTTTCTCTCTAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178794.2-898s1c1
Sequence:CCGGTGGTGCAATGACAGATACCTTCTCGAGAAGGTATCTGTCATTGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178794.2-861s1c1
Sequence:CCGGTGGAAACACTAGTTTCCAAATCTCGAGATTTGGAAACTAGTGTTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178794.2-915s1c1
Sequence:CCGGCCTTTACCCTAAGTAAGTTATCTCGAGATAACTTACTTAGGGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005089
ZRSR2 MISSION shRNA Bacterial Glycerol Stock
zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005089.1-1057s1c1
Sequence:CCGGGACATCTACTTGTCTCCAGATCTCGAGATCTGGAGACAAGTAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005089.1-636s1c1
Sequence:CCGGCATGTTTACGACGTTTGGAATCTCGAGATTCCAAACGTCGTAAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005089.1-498s1c1
Sequence:CCGGACCCGTGGATTTCAGAGTAATCTCGAGATTACTCTGAAATCCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005089.1-1091s1c1
Sequence:CCGGCCTTTGGGAAGAACTCCGAAACTCGAGTTTCGGAGTTCTTCCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005089.1-635s1c1
Sequence:CCGGGCATGTTTACGACGTTTGGAACTCGAGTTCCAAACGTCGTAAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005089.3-519s21c1
Sequence:CCGGACCCGTGGATTTCAGAGTAATCTCGAGATTACTCTGAAATCCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005089.3-595s21c1
Sequence:CCGGGGAGATAGATGTTCACGTAAACTCGAGTTTACGTGAACATCTATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005089.3-1264s21c1
Sequence:CCGGTCTCACAAACGCACATCAAAGCTCGAGCTTTGATGTGCGTTTGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005089.3-745s21c1
Sequence:GTACCGGCAACAGTTCCTAGACTTCTATCTCGAGATAGAAGTCTAGGAACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005089.3-971s21c1
Sequence:CCGGTGGCGATTTGTGGTTTATTTGCTCGAGCAAATAAACCACAAATCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005089
ZRSR2 MISSION shRNA shRNA Plasmid DNA
zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005089.1-1057s1c1
Sequence:CCGGGACATCTACTTGTCTCCAGATCTCGAGATCTGGAGACAAGTAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005089.1-636s1c1
Sequence:CCGGCATGTTTACGACGTTTGGAATCTCGAGATTCCAAACGTCGTAAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005089.1-498s1c1
Sequence:CCGGACCCGTGGATTTCAGAGTAATCTCGAGATTACTCTGAAATCCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005089.1-1091s1c1
Sequence:CCGGCCTTTGGGAAGAACTCCGAAACTCGAGTTTCGGAGTTCTTCCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005089.1-635s1c1
Sequence:CCGGGCATGTTTACGACGTTTGGAACTCGAGTTCCAAACGTCGTAAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005089.3-519s21c1
Sequence:CCGGACCCGTGGATTTCAGAGTAATCTCGAGATTACTCTGAAATCCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005089.3-595s21c1
Sequence:CCGGGGAGATAGATGTTCACGTAAACTCGAGTTTACGTGAACATCTATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005089.3-1264s21c1
Sequence:CCGGTCTCACAAACGCACATCAAAGCTCGAGCTTTGATGTGCGTTTGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005089.3-745s21c1
Sequence:GTACCGGCAACAGTTCCTAGACTTCTATCTCGAGATAGAAGTCTAGGAACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005089.3-971s21c1
Sequence:CCGGTGGCGATTTGTGGTTTATTTGCTCGAGCAAATAAACCACAAATCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005089
ZRSR2 MISSION shRNA Lentiviral Transduction Particles
zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005089.1-1057s1c1
Sequence:CCGGGACATCTACTTGTCTCCAGATCTCGAGATCTGGAGACAAGTAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005089.1-636s1c1
Sequence:CCGGCATGTTTACGACGTTTGGAATCTCGAGATTCCAAACGTCGTAAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005089.1-498s1c1
Sequence:CCGGACCCGTGGATTTCAGAGTAATCTCGAGATTACTCTGAAATCCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005089.1-1091s1c1
Sequence:CCGGCCTTTGGGAAGAACTCCGAAACTCGAGTTTCGGAGTTCTTCCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005089.1-635s1c1
Sequence:CCGGGCATGTTTACGACGTTTGGAACTCGAGTTCCAAACGTCGTAAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005089.3-519s21c1
Sequence:CCGGACCCGTGGATTTCAGAGTAATCTCGAGATTACTCTGAAATCCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005089.3-595s21c1
Sequence:CCGGGGAGATAGATGTTCACGTAAACTCGAGTTTACGTGAACATCTATCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005089.3-1264s21c1
Sequence:CCGGTCTCACAAACGCACATCAAAGCTCGAGCTTTGATGTGCGTTTGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005089.3-745s21c1
Sequence:GTACCGGCAACAGTTCCTAGACTTCTATCTCGAGATAGAAGTCTAGGAACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005089.3-971s21c1
Sequence:CCGGTGGCGATTTGTGGTTTATTTGCTCGAGCAAATAAACCACAAATCGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks