EMAIL THIS PAGE TO A FRIEND

ZSCAN10

zinc finger and SCAN domain containing 10

Synonyms: ZNF206
UniProtKB ID: Q96SZ4, B3KQD3
Gene ID:
Mouse(332221) zinc finger and SCAN domain containing 10
Rat(302962) zinc finger and SCAN domain containing 10
Horse(100068952) zinc finger and SCAN domain containing 10
domestic cat(101097695) zinc finger and SCAN domain containing 10
dog(490045) zinc finger and SCAN domain containing 10
cow(538853) zinc finger and SCAN domain containing 10
sheep(101118749) zinc finger and SCAN domain containing 10
naked mole-rat(101726113) zinc finger and SCAN domain containing 10
domestic guinea pig(100713140) zinc finger and SCAN domain containing 10
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302278 ANTI-ZNF206 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032805 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032805 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032805 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033425 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033425 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033425 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032805 Rosetta Predictions human pricing
NM_001106981 Rosetta Predictions rat pricing
NM_001033425 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105117 predicted 2122
2 SASI_Hs01_00105118 predicted 563
3 SASI_Hs01_00105119 predicted 936
4 SASI_Hs01_00105121 predicted 660
5 SASI_Hs01_00105122 predicted 655
6 SASI_Hs01_00105123 predicted 1335
7 SASI_Hs01_00105124 predicted 1678
8 SASI_Hs01_00105125 predicted 883
9 SASI_Hs01_00105126 predicted 703
10 SASI_Hs02_00360369 predicted 1343
11 SASI_Hs01_00105120 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224306 predicted 795
2 SASI_Rn02_00224307 predicted 1259
3 SASI_Rn02_00224308 predicted 1589
4 SASI_Rn02_00224309 predicted 957
5 SASI_Rn02_00224310 predicted 2358
6 SASI_Rn02_00224311 predicted 1831
7 SASI_Rn02_00224312 predicted 254
8 SASI_Rn02_00224313 predicted 548
9 SASI_Rn02_00224314 predicted 853
10 SASI_Rn02_00224315 predicted 1819
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288735 predicted 1792
2 SASI_Mm01_00109567 predicted 1769
3 SASI_Mm01_00109568 predicted 1543
4 SASI_Mm01_00109569 predicted 898
5 SASI_Mm01_00109570 predicted 929
6 SASI_Mm01_00109571 predicted 1549
7 SASI_Mm02_00288736 predicted 898
8 SASI_Mm01_00109572 predicted 219
9 SASI_Mm01_00109573 predicted 1738
10 SASI_Mm02_00288737 predicted 975
11 SASI_Mm01_00109566 predicted 1792
12 SASI_Mm01_00109574 predicted 1194
13 SASI_Mm01_00109575 predicted 972
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032805
ZSCAN10 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032805.1-727s1c1
Sequence:CCGGCCCAGACAAGGAGGAATTTAACTCGAGTTAAATTCCTCCTTGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032805.1-1087s1c1
Sequence:CCGGCTCCATTCTCAAGCTGCACATCTCGAGATGTGCAGCTTGAGAATGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032805.1-611s1c1
Sequence:CCGGCCAGAGGAGAGTTCCCGAGATCTCGAGATCTCGGGAACTCTCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032805.1-1926s1c1
Sequence:CCGGGCCACCGTTTCCGCAATAGCTCTCGAGAGCTATTGCGGAAACGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032805.1-327s1c1
Sequence:CCGGGTTGTAATGCTGGCAAGAGTTCTCGAGAACTCTTGCCAGCATTACAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032805.1-415s21c1
Sequence:CCGGGAAGGAATTGCCTGCGGAAGACTCGAGTCTTCCGCAGGCAATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032805.1-357s21c1
Sequence:CCGGCAGACGTCACCTTGGAGGAAACTCGAGTTTCCTCCAAGGTGACGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032805.1-948s21c1
Sequence:CCGGATCCGGAGTTGCAGTTCATCTCTCGAGAGATGAACTGCAACTCCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032805
ZSCAN10 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032805.1-727s1c1
Sequence:CCGGCCCAGACAAGGAGGAATTTAACTCGAGTTAAATTCCTCCTTGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032805.1-1087s1c1
Sequence:CCGGCTCCATTCTCAAGCTGCACATCTCGAGATGTGCAGCTTGAGAATGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032805.1-611s1c1
Sequence:CCGGCCAGAGGAGAGTTCCCGAGATCTCGAGATCTCGGGAACTCTCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032805.1-1926s1c1
Sequence:CCGGGCCACCGTTTCCGCAATAGCTCTCGAGAGCTATTGCGGAAACGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032805.1-327s1c1
Sequence:CCGGGTTGTAATGCTGGCAAGAGTTCTCGAGAACTCTTGCCAGCATTACAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032805.1-415s21c1
Sequence:CCGGGAAGGAATTGCCTGCGGAAGACTCGAGTCTTCCGCAGGCAATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032805.1-357s21c1
Sequence:CCGGCAGACGTCACCTTGGAGGAAACTCGAGTTTCCTCCAAGGTGACGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032805.1-948s21c1
Sequence:CCGGATCCGGAGTTGCAGTTCATCTCTCGAGAGATGAACTGCAACTCCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032805
ZSCAN10 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032805.1-727s1c1
Sequence:CCGGCCCAGACAAGGAGGAATTTAACTCGAGTTAAATTCCTCCTTGTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032805.1-1087s1c1
Sequence:CCGGCTCCATTCTCAAGCTGCACATCTCGAGATGTGCAGCTTGAGAATGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032805.1-611s1c1
Sequence:CCGGCCAGAGGAGAGTTCCCGAGATCTCGAGATCTCGGGAACTCTCCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032805.1-1926s1c1
Sequence:CCGGGCCACCGTTTCCGCAATAGCTCTCGAGAGCTATTGCGGAAACGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032805.1-327s1c1
Sequence:CCGGGTTGTAATGCTGGCAAGAGTTCTCGAGAACTCTTGCCAGCATTACAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032805.1-415s21c1
Sequence:CCGGGAAGGAATTGCCTGCGGAAGACTCGAGTCTTCCGCAGGCAATTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032805.1-357s21c1
Sequence:CCGGCAGACGTCACCTTGGAGGAAACTCGAGTTTCCTCCAAGGTGACGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032805.1-948s21c1
Sequence:CCGGATCCGGAGTTGCAGTTCATCTCTCGAGAGATGAACTGCAACTCCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033425
ZSCAN10 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033425.3-2528s21c1
Sequence:CCGGACCCATGTTCCAGCAACCTTGCTCGAGCAAGGTTGCTGGAACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033425.3-1771s21c1
Sequence:CCGGCGACAAAGCGAGCAACTAATGCTCGAGCATTAGTTGCTCGCTTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033425.3-969s21c1
Sequence:CCGGGCCTGACAATGAGGAACTTAACTCGAGTTAAGTTCCTCATTGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033425.3-1010s21c1
Sequence:CCGGCTACTTGGCCTGTCGTCATTGCTCGAGCAATGACGACAGGCCAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033425.3-504s21c1
Sequence:CCGGAGAGGAGGTGGTACAGCTATTCTCGAGAATAGCTGTACCACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033425
ZSCAN10 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033425.3-2528s21c1
Sequence:CCGGACCCATGTTCCAGCAACCTTGCTCGAGCAAGGTTGCTGGAACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033425.3-1771s21c1
Sequence:CCGGCGACAAAGCGAGCAACTAATGCTCGAGCATTAGTTGCTCGCTTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033425.3-969s21c1
Sequence:CCGGGCCTGACAATGAGGAACTTAACTCGAGTTAAGTTCCTCATTGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033425.3-1010s21c1
Sequence:CCGGCTACTTGGCCTGTCGTCATTGCTCGAGCAATGACGACAGGCCAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033425.3-504s21c1
Sequence:CCGGAGAGGAGGTGGTACAGCTATTCTCGAGAATAGCTGTACCACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033425
ZSCAN10 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033425.3-2528s21c1
Sequence:CCGGACCCATGTTCCAGCAACCTTGCTCGAGCAAGGTTGCTGGAACATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033425.3-1771s21c1
Sequence:CCGGCGACAAAGCGAGCAACTAATGCTCGAGCATTAGTTGCTCGCTTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033425.3-969s21c1
Sequence:CCGGGCCTGACAATGAGGAACTTAACTCGAGTTAAGTTCCTCATTGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033425.3-1010s21c1
Sequence:CCGGCTACTTGGCCTGTCGTCATTGCTCGAGCAATGACGACAGGCCAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033425.3-504s21c1
Sequence:CCGGAGAGGAGGTGGTACAGCTATTCTCGAGAATAGCTGTACCACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks