EMAIL THIS PAGE TO A FRIEND

ZSCAN12

zinc finger and SCAN domain containing 12

Synonyms: ZFP96 ZNF29K1 ZNF305 ZNF96 dJ29K1.2
UniProtKB ID: O43309, O43724
Gene ID:
Mouse(22758) zinc finger and SCAN domain containing 12
Rat(266716) zinc finger and SCAN domain containing 12
cow(768084) zinc finger and SCAN domain containing 12
domestic cat(101090614) zinc finger and SCAN domain containing 12
dog(100683086) zinc finger and SCAN domain containing 12
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001163391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001163391 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016684 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016684 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016684 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014724 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014724 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014724 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039643 Rosetta Predictions human pricing
XR_041200 Rosetta Predictions human pricing
XR_041201 Rosetta Predictions human pricing
XR_041202 Rosetta Predictions human pricing
NM_153475 Rosetta Predictions rat pricing
XM_579682 Rosetta Predictions rat pricing
NM_016684 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119972 predicted 1291
2 SASI_Hs01_00119973 predicted 897
3 SASI_Hs01_00119974 predicted 1088
4 SASI_Hs01_00119975 predicted 652
5 SASI_Hs01_00119976 predicted 1940
6 SASI_Hs01_00119977 predicted 1285
7 SASI_Hs01_00119978 predicted 919
8 SASI_Hs01_00119979 predicted 1216
9 SASI_Hs01_00119980 predicted 1919
10 SASI_Hs01_00119981 predicted 1271
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525472 predicted 1581
2 SASI_Hs02_00525473 predicted 1296
3 SASI_Hs02_00525474 predicted 904
4 SASI_Hs02_00525475 predicted 2411
5 SASI_Hs02_00525476 predicted 1084
6 SASI_Hs02_00525477 predicted 651
7 SASI_Hs02_00525478 predicted 1283
8 SASI_Hs02_00525479 predicted 917
9 SASI_Hs02_00525480 predicted 1215
10 SASI_Hs02_00525481 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525482 predicted 1574
2 SASI_Hs02_00525483 predicted 1301
3 SASI_Hs02_00525484 predicted 905
4 SASI_Hs02_00525485 predicted 1090
5 SASI_Hs02_00525486 predicted 1299
6 SASI_Hs02_00525487 predicted 649
7 SASI_Hs02_00525488 predicted 1291
8 SASI_Hs02_00525489 predicted 914
9 SASI_Hs02_00525490 predicted 1214
10 SASI_Hs02_00525491 predicted 1272
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525492 predicted 1305
2 SASI_Hs02_00525493 predicted 898
3 SASI_Hs02_00525494 predicted 1092
4 SASI_Hs02_00525495 predicted 2904
5 SASI_Hs02_00525496 predicted 2888
6 SASI_Hs02_00525497 predicted 1941
7 SASI_Hs02_00525498 predicted 2878
8 SASI_Hs02_00525499 predicted 2669
9 SASI_Hs02_00525500 predicted 1292
10 SASI_Hs02_00525501 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153475 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057652 predicted 663
2 SASI_Rn01_00057653 predicted 549
3 SASI_Rn01_00057654 predicted 1239
4 SASI_Rn01_00057655 predicted 704
5 SASI_Rn01_00057656 predicted 1287
6 SASI_Rn01_00057657 predicted 1107
7 SASI_Rn01_00057658 predicted 985
8 SASI_Rn01_00057659 predicted 1359
9 SASI_Rn01_00057660 predicted 668
10 SASI_Rn01_00057661 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579682 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00191019 predicted 947
2 SASI_Rn01_00191020 predicted 850
3 SASI_Rn01_00191021 predicted 1239
4 SASI_Rn01_00191022 predicted 979
5 SASI_Rn01_00191023 predicted 1076
6 SASI_Rn01_00191024 predicted 1284
7 SASI_Rn01_00191025 predicted 1113
8 SASI_Rn01_00191026 predicted 994
9 SASI_Rn01_00191027 predicted 1202
10 SASI_Rn01_00191028 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200005 predicted 1524
2 SASI_Mm01_00200006 predicted 204
3 SASI_Mm02_00323336 predicted 1529
4 SASI_Mm01_00200007 predicted 1131
5 SASI_Mm01_00200008 predicted 530
6 SASI_Mm01_00200009 predicted 1435
7 SASI_Mm02_00323337 predicted 1618
8 SASI_Mm01_00200011 predicted 1228
9 SASI_Mm01_00200012 predicted 1599
10 SASI_Mm01_00200013 predicted 1257
11 SASI_Mm01_00200010 predicted 503
12 SASI_Mm01_00200014 predicted 2010
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163391
ZSCAN12 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 12
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000435970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163391.1-2238s21c1
Sequence:CCGGGATCCACATATTTAGTCATATCTCGAGATATGACTAAATATGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163391.1-1336s21c1
Sequence:CCGGATCAGTGCACTCAGTGTAATACTCGAGTATTACACTGAGTGCACTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163391.1-745s21c1
Sequence:CCGGGAAATGAGTATGGGAATTTAACTCGAGTTAAATTCCCATACTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163391
ZSCAN12 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 12
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000435970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163391.1-2238s21c1
Sequence:CCGGGATCCACATATTTAGTCATATCTCGAGATATGACTAAATATGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163391.1-1336s21c1
Sequence:CCGGATCAGTGCACTCAGTGTAATACTCGAGTATTACACTGAGTGCACTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163391.1-745s21c1
Sequence:CCGGGAAATGAGTATGGGAATTTAACTCGAGTTAAATTCCCATACTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163391
ZSCAN12 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 12
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000435970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163391.1-2238s21c1
Sequence:CCGGGATCCACATATTTAGTCATATCTCGAGATATGACTAAATATGTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163391.1-1336s21c1
Sequence:CCGGATCAGTGCACTCAGTGTAATACTCGAGTATTACACTGAGTGCACTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163391.1-745s21c1
Sequence:CCGGGAAATGAGTATGGGAATTTAACTCGAGTTAAATTCCCATACTCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016684
VALIDATED
ZSCAN12 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016684.2-1700s21c1
Sequence:CCGGGCTGAGCACTAGAGAATTCATCTCGAGATGAATTCTCTAGTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016684.2-1430s21c1
Sequence:CCGGCCTTCACTCAAAGTGGTCCTACTCGAGTAGGACCACTTTGAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016684.2-185s21c1
Sequence:CCGGTGGAGGAAGAATGTAAGTATACTCGAGTATACTTACATTCTTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016684.2-1594s21c1
Sequence:CCGGGCCTTTATTCAGATGTCAGAACTCGAGTTCTGACATCTGAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016684.1-1903s1c1
Sequence:CCGGGCCTTTATTCAGATGTCAGAACTCGAGTTCTGACATCTGAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016684.1-1186s1c1
Sequence:CCGGGCGAACTCAGAGTACGCTAAACTCGAGTTTAGCGTACTCTGAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016684.1-1739s1c1
Sequence:CCGGCCTTCACTCAAAGTGGTCCTACTCGAGTAGGACCACTTTGAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016684.1-2009s1c1
Sequence:CCGGGCTGAGCACTAGAGAATTCATCTCGAGATGAATTCTCTAGTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016684.1-494s1c1
Sequence:CCGGTGGAGGAAGAATGTAAGTATACTCGAGTATACTTACATTCTTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016684
VALIDATED
ZSCAN12 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016684.2-1700s21c1
Sequence:CCGGGCTGAGCACTAGAGAATTCATCTCGAGATGAATTCTCTAGTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016684.2-1430s21c1
Sequence:CCGGCCTTCACTCAAAGTGGTCCTACTCGAGTAGGACCACTTTGAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016684.2-185s21c1
Sequence:CCGGTGGAGGAAGAATGTAAGTATACTCGAGTATACTTACATTCTTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016684.2-1594s21c1
Sequence:CCGGGCCTTTATTCAGATGTCAGAACTCGAGTTCTGACATCTGAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016684.1-1903s1c1
Sequence:CCGGGCCTTTATTCAGATGTCAGAACTCGAGTTCTGACATCTGAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016684.1-1186s1c1
Sequence:CCGGGCGAACTCAGAGTACGCTAAACTCGAGTTTAGCGTACTCTGAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016684.1-1739s1c1
Sequence:CCGGCCTTCACTCAAAGTGGTCCTACTCGAGTAGGACCACTTTGAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016684.1-2009s1c1
Sequence:CCGGGCTGAGCACTAGAGAATTCATCTCGAGATGAATTCTCTAGTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016684.1-494s1c1
Sequence:CCGGTGGAGGAAGAATGTAAGTATACTCGAGTATACTTACATTCTTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016684
VALIDATED
ZSCAN12 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016684.2-1700s21c1
Sequence:CCGGGCTGAGCACTAGAGAATTCATCTCGAGATGAATTCTCTAGTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016684.2-1430s21c1
Sequence:CCGGCCTTCACTCAAAGTGGTCCTACTCGAGTAGGACCACTTTGAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016684.2-185s21c1
Sequence:CCGGTGGAGGAAGAATGTAAGTATACTCGAGTATACTTACATTCTTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016684.2-1594s21c1
Sequence:CCGGGCCTTTATTCAGATGTCAGAACTCGAGTTCTGACATCTGAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016684.1-1903s1c1
Sequence:CCGGGCCTTTATTCAGATGTCAGAACTCGAGTTCTGACATCTGAATAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016684.1-1186s1c1
Sequence:CCGGGCGAACTCAGAGTACGCTAAACTCGAGTTTAGCGTACTCTGAGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016684.1-1739s1c1
Sequence:CCGGCCTTCACTCAAAGTGGTCCTACTCGAGTAGGACCACTTTGAGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016684.1-2009s1c1
Sequence:CCGGGCTGAGCACTAGAGAATTCATCTCGAGATGAATTCTCTAGTGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016684.1-494s1c1
Sequence:CCGGTGGAGGAAGAATGTAAGTATACTCGAGTATACTTACATTCTTCCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014724
ZSCAN12 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014724.2-3168s1c1
Sequence:CCGGCCTGGATGATTATCTCTGTTTCTCGAGAAACAGAGATAATCATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014724.2-648s1c1
Sequence:CCGGCCAAAGTATGAATCTCCAGAACTCGAGTTCTGGAGATTCATACTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014724.2-862s1c1
Sequence:CCGGCCAGAGAAGATAAACAACCTACTCGAGTAGGTTGTTTATCTTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014724.2-1436s1c1
Sequence:CCGGCCATCAGGAAATCCACCACAACTCGAGTTGTGGTGGATTTCCTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014724.2-1335s1c1
Sequence:CCGGCGTTCCATACTTACTCAGCATCTCGAGATGCTGAGTAAGTATGGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014724
ZSCAN12 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014724.2-3168s1c1
Sequence:CCGGCCTGGATGATTATCTCTGTTTCTCGAGAAACAGAGATAATCATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014724.2-648s1c1
Sequence:CCGGCCAAAGTATGAATCTCCAGAACTCGAGTTCTGGAGATTCATACTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014724.2-862s1c1
Sequence:CCGGCCAGAGAAGATAAACAACCTACTCGAGTAGGTTGTTTATCTTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014724.2-1436s1c1
Sequence:CCGGCCATCAGGAAATCCACCACAACTCGAGTTGTGGTGGATTTCCTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014724.2-1335s1c1
Sequence:CCGGCGTTCCATACTTACTCAGCATCTCGAGATGCTGAGTAAGTATGGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014724
ZSCAN12 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014724.2-3168s1c1
Sequence:CCGGCCTGGATGATTATCTCTGTTTCTCGAGAAACAGAGATAATCATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014724.2-648s1c1
Sequence:CCGGCCAAAGTATGAATCTCCAGAACTCGAGTTCTGGAGATTCATACTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014724.2-862s1c1
Sequence:CCGGCCAGAGAAGATAAACAACCTACTCGAGTAGGTTGTTTATCTTCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014724.2-1436s1c1
Sequence:CCGGCCATCAGGAAATCCACCACAACTCGAGTTGTGGTGGATTTCCTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014724.2-1335s1c1
Sequence:CCGGCGTTCCATACTTACTCAGCATCTCGAGATGCTGAGTAAGTATGGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks