EMAIL THIS PAGE TO A FRIEND

ZSCAN16

zinc finger and SCAN domain containing 16

Synonyms: ZNF392 ZNF435 dJ265C24.3
UniProtKB ID: Q9H4T2, Q9H6K2
Gene ID:
Horse(100629134) zinc finger and SCAN domain containing 16
cow(511795) zinc finger and SCAN domain containing 16
sheep(101104351) zinc finger and SCAN domain containing 16
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025231 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025231 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025231 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025231 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025231 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240766 predicted 664
2 SASI_Hs01_00240767 predicted 470
3 SASI_Hs01_00240768 predicted 934
4 SASI_Hs01_00240769 predicted 715
5 SASI_Hs01_00240770 predicted 789
6 SASI_Hs01_00240771 predicted 614
7 SASI_Hs01_00240772 predicted 268
8 SASI_Hs01_00240773 predicted 207
9 SASI_Hs02_00358043 predicted 506
10 SASI_Hs01_00240774 predicted 942
11 SASI_Hs01_00240775 predicted 700
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025231
ZSCAN16 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 16
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025231.1-614s1c1
Sequence:CCGGCCACAAAGGAATGGTGATAAACTCGAGTTTATCACCATTCCTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025231.1-1087s1c1
Sequence:CCGGCCGAGTAAGTTCAGCTCTTATCTCGAGATAAGAGCTGAACTTACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025231.1-736s1c1
Sequence:CCGGGCATCCTAAGTCCAAAGATATCTCGAGATATCTTTGGACTTAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025231.1-496s1c1
Sequence:CCGGCAATTCAGAAAGACGGGACATCTCGAGATGTCCCGTCTTTCTGAATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025231.1-947s1c1
Sequence:CCGGCATAGAGTACACACGGGAGTACTCGAGTACTCCCGTGTGTACTCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025231.1-1004s21c1
Sequence:CCGGAGTGGGCGCACAGGTCTTATTCTCGAGAATAAGACCTGTGCGCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025231.1-1127s21c1
Sequence:CCGGACCGCAAATAAACTCTACTAACTCGAGTTAGTAGAGTTTATTTGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025231.1-790s21c1
Sequence:CCGGGAGGGAAAGAAGACGATATAACTCGAGTTATATCGTCTTCTTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025231
ZSCAN16 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 16
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025231.1-614s1c1
Sequence:CCGGCCACAAAGGAATGGTGATAAACTCGAGTTTATCACCATTCCTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025231.1-1087s1c1
Sequence:CCGGCCGAGTAAGTTCAGCTCTTATCTCGAGATAAGAGCTGAACTTACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025231.1-736s1c1
Sequence:CCGGGCATCCTAAGTCCAAAGATATCTCGAGATATCTTTGGACTTAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025231.1-496s1c1
Sequence:CCGGCAATTCAGAAAGACGGGACATCTCGAGATGTCCCGTCTTTCTGAATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025231.1-947s1c1
Sequence:CCGGCATAGAGTACACACGGGAGTACTCGAGTACTCCCGTGTGTACTCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025231.1-1004s21c1
Sequence:CCGGAGTGGGCGCACAGGTCTTATTCTCGAGAATAAGACCTGTGCGCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025231.1-1127s21c1
Sequence:CCGGACCGCAAATAAACTCTACTAACTCGAGTTAGTAGAGTTTATTTGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025231.1-790s21c1
Sequence:CCGGGAGGGAAAGAAGACGATATAACTCGAGTTATATCGTCTTCTTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025231
ZSCAN16 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 16
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025231.1-614s1c1
Sequence:CCGGCCACAAAGGAATGGTGATAAACTCGAGTTTATCACCATTCCTTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025231.1-1087s1c1
Sequence:CCGGCCGAGTAAGTTCAGCTCTTATCTCGAGATAAGAGCTGAACTTACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025231.1-736s1c1
Sequence:CCGGGCATCCTAAGTCCAAAGATATCTCGAGATATCTTTGGACTTAGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025231.1-496s1c1
Sequence:CCGGCAATTCAGAAAGACGGGACATCTCGAGATGTCCCGTCTTTCTGAATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025231.1-947s1c1
Sequence:CCGGCATAGAGTACACACGGGAGTACTCGAGTACTCCCGTGTGTACTCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025231.1-1004s21c1
Sequence:CCGGAGTGGGCGCACAGGTCTTATTCTCGAGAATAAGACCTGTGCGCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025231.1-1127s21c1
Sequence:CCGGACCGCAAATAAACTCTACTAACTCGAGTTAGTAGAGTTTATTTGCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025231.1-790s21c1
Sequence:CCGGGAGGGAAAGAAGACGATATAACTCGAGTTATATCGTCTTCTTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks