EMAIL THIS PAGE TO A FRIEND

ZSCAN18

zinc finger and SCAN domain containing 18

Synonyms: ZNF447
UniProtKB ID: Q8TBC5, B4DG23, E9PBI0, Q9BRK7, Q9H9A0
Gene ID:
Mouse(232875) zinc finger and SCAN domain containing 18
Rat(499083) zinc finger and SCAN domain containing 18
domestic cat(101090474) zinc finger and SCAN domain containing 18
naked mole-rat(101698345) zinc finger and SCAN domain containing 18
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023926 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023926 Rosetta Predictions human pricing
XM_001063062 Rosetta Predictions rat pricing
XM_574367 Rosetta Predictions rat pricing
NM_001017955 Rosetta Predictions mouse pricing
XM_001476882 Rosetta Predictions mouse pricing
XM_001478350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058423 predicted 1552
2 SASI_Hs01_00058424 predicted 2216
3 SASI_Hs01_00058425 predicted 2089
4 SASI_Hs01_00058426 predicted 1962
5 SASI_Hs01_00058427 predicted 2225
6 SASI_Hs01_00058428 predicted 1874
7 SASI_Hs01_00058429 predicted 1632
8 SASI_Hs01_00058430 predicted 493
9 SASI_Hs02_00356384 predicted 1743
10 SASI_Hs02_00356385 predicted 2254
11 SASI_Hs01_00058421 predicted 2234
12 SASI_Hs01_00058422 predicted 1488
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063062 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305612 predicted 2160
2 SASI_Rn02_00305613 predicted 2232
3 SASI_Rn02_00305614 predicted 854
4 SASI_Rn02_00305615 predicted 1877
5 SASI_Rn02_00305616 predicted 2454
6 SASI_Rn02_00305617 predicted 1727
7 SASI_Rn02_00305618 predicted 2077
8 SASI_Rn02_00305619 predicted 2307
9 SASI_Rn02_00305620 predicted 1213
10 SASI_Rn02_00305621 predicted 2487
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574367 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401861 predicted 580
2 SASI_Rn02_00401862 predicted 854
3 SASI_Rn02_00401863 predicted 1100
4 SASI_Rn02_00401864 predicted 1049
5 SASI_Rn02_00401865 predicted 632
6 SASI_Rn02_00401866 predicted 1728
7 SASI_Rn02_00401867 predicted 311
8 SASI_Rn02_00401868 predicted 1308
9 SASI_Rn02_00401869 predicted 1220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017955 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163275 predicted 1125
2 SASI_Mm01_00163276 predicted 899
3 SASI_Mm01_00163277 predicted 986
4 SASI_Mm01_00163278 predicted 658
5 SASI_Mm01_00163279 predicted 1047
6 SASI_Mm01_00163280 predicted 650
7 SASI_Mm01_00163281 predicted 1278
8 SASI_Mm01_00163282 predicted 1034
9 SASI_Mm01_00163283 predicted 1121
10 SASI_Mm01_00163284 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00391936 predicted 2917
2 SASI_Mm02_00391937 predicted 2206
3 SASI_Mm02_00391938 predicted 2425
4 SASI_Mm02_00391939 predicted 2673
5 SASI_Mm02_00391940 predicted 635
6 SASI_Mm02_00391941 predicted 2292
7 SASI_Mm02_00391942 predicted 1939
8 SASI_Mm02_00391943 predicted 582
9 SASI_Mm02_00391944 predicted 2757
10 SASI_Mm02_00391945 predicted 983
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00402070 predicted 3144
2 SASI_Mm02_00402071 predicted 2915
3 SASI_Mm02_00402072 predicted 3004
4 SASI_Mm02_00402073 predicted 2677
5 SASI_Mm02_00402074 predicted 3067
6 SASI_Mm02_00402075 predicted 3297
7 SASI_Mm02_00402076 predicted 3055
8 SASI_Mm02_00402077 predicted 3139
9 SASI_Mm02_00402078 predicted 2753
10 SASI_Mm02_00402079 predicted 3132
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023926
ZSCAN18 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 18
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023926.3-545s21c1
Sequence:CCGGCGCCTGCGTTTCCGGGAATTTCTCGAGAAATTCCCGGAAACGCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023926.3-826s21c1
Sequence:CCGGGGGCTCATCCTCAATTCTTAGCTCGAGCTAAGAATTGAGGATGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023926.3-2431s21c1
Sequence:CCGGTCGCGTGTGTTTACCTATATGCTCGAGCATATAGGTAAACACACGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023926.3-998s21c1
Sequence:CCGGAGAGAAGCAAAGACCGAAGAGCTCGAGCTCTTCGGTCTTTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023926.3-736s21c1
Sequence:CCGGGTACCCTGAGAGCTGCAAGAACTCGAGTTCTTGCAGCTCTCAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023926.3-545s1c1
Sequence:CCGGCGCCTGCGTTTCCGGGAATTTCTCGAGAAATTCCCGGAAACGCAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023926.3-1774s1c1
Sequence:CCGGGCACCAGAAGACCCACGAGAACTCGAGTTCTCGTGGGTCTTCTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023926.3-1666s1c1
Sequence:CCGGCGCGTGGCTCTCGCACCTGATCTCGAGATCAGGTGCGAGAGCCACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023926.3-1206s1c1
Sequence:CCGGTGGAAAGAGATCCACAAGGAACTCGAGTTCCTTGTGGATCTCTTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023926
ZSCAN18 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 18
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023926.3-545s21c1
Sequence:CCGGCGCCTGCGTTTCCGGGAATTTCTCGAGAAATTCCCGGAAACGCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023926.3-826s21c1
Sequence:CCGGGGGCTCATCCTCAATTCTTAGCTCGAGCTAAGAATTGAGGATGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023926.3-2431s21c1
Sequence:CCGGTCGCGTGTGTTTACCTATATGCTCGAGCATATAGGTAAACACACGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023926.3-998s21c1
Sequence:CCGGAGAGAAGCAAAGACCGAAGAGCTCGAGCTCTTCGGTCTTTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023926.3-736s21c1
Sequence:CCGGGTACCCTGAGAGCTGCAAGAACTCGAGTTCTTGCAGCTCTCAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023926.3-545s1c1
Sequence:CCGGCGCCTGCGTTTCCGGGAATTTCTCGAGAAATTCCCGGAAACGCAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023926.3-1774s1c1
Sequence:CCGGGCACCAGAAGACCCACGAGAACTCGAGTTCTCGTGGGTCTTCTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023926.3-1666s1c1
Sequence:CCGGCGCGTGGCTCTCGCACCTGATCTCGAGATCAGGTGCGAGAGCCACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023926.3-1206s1c1
Sequence:CCGGTGGAAAGAGATCCACAAGGAACTCGAGTTCCTTGTGGATCTCTTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023926
ZSCAN18 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 18
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023926.3-545s21c1
Sequence:CCGGCGCCTGCGTTTCCGGGAATTTCTCGAGAAATTCCCGGAAACGCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023926.3-826s21c1
Sequence:CCGGGGGCTCATCCTCAATTCTTAGCTCGAGCTAAGAATTGAGGATGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023926.3-2431s21c1
Sequence:CCGGTCGCGTGTGTTTACCTATATGCTCGAGCATATAGGTAAACACACGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023926.3-998s21c1
Sequence:CCGGAGAGAAGCAAAGACCGAAGAGCTCGAGCTCTTCGGTCTTTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023926.3-736s21c1
Sequence:CCGGGTACCCTGAGAGCTGCAAGAACTCGAGTTCTTGCAGCTCTCAGGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023926.3-545s1c1
Sequence:CCGGCGCCTGCGTTTCCGGGAATTTCTCGAGAAATTCCCGGAAACGCAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023926.3-1774s1c1
Sequence:CCGGGCACCAGAAGACCCACGAGAACTCGAGTTCTCGTGGGTCTTCTGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023926.3-1666s1c1
Sequence:CCGGCGCGTGGCTCTCGCACCTGATCTCGAGATCAGGTGCGAGAGCCACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023926.3-1206s1c1
Sequence:CCGGTGGAAAGAGATCCACAAGGAACTCGAGTTCCTTGTGGATCTCTTTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks