EMAIL THIS PAGE TO A FRIEND

ZSCAN20

zinc finger and SCAN domain containing 20

Synonyms: KOX29 ZFP-31 ZNF31 ZNF360
Gene ID:
Mouse(269585) zinc finger and SCAN domains 20
Rat(500549) zinc finger and SCAN domain containing 20
domestic cat(101082762) zinc finger and SCAN domain containing 20
Horse(100068602) zinc finger and SCAN domain containing 20
Horse(100069958) zinc finger and SCAN domain containing 20
dog(487295) zinc finger and SCAN domain containing 20
cow(538651) zinc finger and SCAN domain containing 20
sheep(101106119) zinc finger and SCAN domain containing 20
domestic guinea pig(100725209) zinc finger and SCAN domain containing 20
naked mole-rat(101702076) zinc finger and SCAN domain containing 20
Domestic Rabbit(100338529) zinc finger and SCAN domain containing 20
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145238 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177758 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177758 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177758 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145238 Rosetta Predictions human pricing
XM_001059988 Rosetta Predictions rat pricing
XM_575911 Rosetta Predictions rat pricing
NM_177758 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058139 predicted 2946
2 SASI_Hs01_00058140 predicted 1281
3 SASI_Hs01_00058141 predicted 2217
4 SASI_Hs02_00365077 predicted 1843
5 SASI_Hs01_00058142 predicted 2332
6 SASI_Hs02_00365078 predicted 991
7 SASI_Hs01_00058145 predicted 2374
8 SASI_Hs02_00365079 predicted 591
9 SASI_Hs01_00058147 predicted 2488
10 SASI_Hs02_00365080 predicted 2585
11 SASI_Hs01_00058143 predicted 2590
12 SASI_Hs01_00058144 predicted 2653
13 SASI_Hs01_00058146 predicted 726
14 SASI_Hs01_00058148 predicted 3101
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295050 predicted 655
2 SASI_Rn02_00295051 predicted 2189
3 SASI_Rn02_00295052 predicted 2155
4 SASI_Rn02_00295053 predicted 2601
5 SASI_Rn02_00295054 predicted 2145
6 SASI_Rn02_00295055 predicted 218
7 SASI_Rn02_00295056 predicted 2117
8 SASI_Rn02_00295057 predicted 1711
9 SASI_Rn02_00295058 predicted 2546
10 SASI_Rn02_00295059 predicted 2309
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404498 predicted 2359
2 SASI_Rn02_00404499 predicted 2359
3 SASI_Rn02_00404500 predicted 2395
4 SASI_Rn02_00404501 predicted 2405
5 SASI_Rn02_00404502 predicted 2322
6 SASI_Rn02_00404503 predicted 2391
7 SASI_Rn02_00404504 predicted 2328
8 SASI_Rn02_00404505 predicted 2413
9 SASI_Rn02_00404506 predicted 2419
10 SASI_Rn02_00404507 predicted 2355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053500 predicted 2057
2 SASI_Mm01_00053501 predicted 2129
3 SASI_Mm01_00053502 predicted 2302
4 SASI_Mm01_00053503 predicted 2657
5 SASI_Mm02_00348135 predicted 1245
6 SASI_Mm01_00053505 predicted 2547
7 SASI_Mm01_00053506 predicted 2143
8 SASI_Mm01_00053508 predicted 2090
9 SASI_Mm01_00053509 predicted 3390
10 SASI_Mm02_00348136 predicted 1737
11 SASI_Mm01_00053504 predicted 1307
12 SASI_Mm01_00053507 predicted 1143
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145238
ZSCAN20 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 20
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145238.3-3587s21c1
Sequence:CCGGCTTACGAGATTAGAGTTAAATCTCGAGATTTAACTCTAATCTCGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145238.3-2721s21c1
Sequence:CCGGCAACCTCAAAGTATCAGTAAGCTCGAGCTTACTGATACTTTGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145238.3-717s21c1
Sequence:CCGGGACCTTCCCAATCACCTAAATCTCGAGATTTAGGTGATTGGGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145238.2-3205s1c1
Sequence:CCGGCCAGGTAATTTGGAAGTGAATCTCGAGATTCACTTCCAAATTACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145238.2-1319s1c1
Sequence:CCGGGCCTGGTCAATGTTGAGTCTACTCGAGTAGACTCAACATTGACCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145238.2-1786s1c1
Sequence:CCGGCCTTCAACCTTGTGTCCTAAACTCGAGTTTAGGACACAAGGTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145238.2-730s1c1
Sequence:CCGGCCAAGTAATACCTCCGAGAAACTCGAGTTTCTCGGAGGTATTACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145238.2-2851s1c1
Sequence:CCGGCGTGACCGTTCTAACCTCATTCTCGAGAATGAGGTTAGAACGGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145238
ZSCAN20 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 20
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145238.3-3587s21c1
Sequence:CCGGCTTACGAGATTAGAGTTAAATCTCGAGATTTAACTCTAATCTCGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145238.3-2721s21c1
Sequence:CCGGCAACCTCAAAGTATCAGTAAGCTCGAGCTTACTGATACTTTGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145238.3-717s21c1
Sequence:CCGGGACCTTCCCAATCACCTAAATCTCGAGATTTAGGTGATTGGGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145238.2-3205s1c1
Sequence:CCGGCCAGGTAATTTGGAAGTGAATCTCGAGATTCACTTCCAAATTACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145238.2-1319s1c1
Sequence:CCGGGCCTGGTCAATGTTGAGTCTACTCGAGTAGACTCAACATTGACCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145238.2-1786s1c1
Sequence:CCGGCCTTCAACCTTGTGTCCTAAACTCGAGTTTAGGACACAAGGTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145238.2-730s1c1
Sequence:CCGGCCAAGTAATACCTCCGAGAAACTCGAGTTTCTCGGAGGTATTACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145238.2-2851s1c1
Sequence:CCGGCGTGACCGTTCTAACCTCATTCTCGAGAATGAGGTTAGAACGGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145238
ZSCAN20 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 20
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145238.3-3587s21c1
Sequence:CCGGCTTACGAGATTAGAGTTAAATCTCGAGATTTAACTCTAATCTCGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145238.3-2721s21c1
Sequence:CCGGCAACCTCAAAGTATCAGTAAGCTCGAGCTTACTGATACTTTGAGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145238.3-717s21c1
Sequence:CCGGGACCTTCCCAATCACCTAAATCTCGAGATTTAGGTGATTGGGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145238.2-3205s1c1
Sequence:CCGGCCAGGTAATTTGGAAGTGAATCTCGAGATTCACTTCCAAATTACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145238.2-1319s1c1
Sequence:CCGGGCCTGGTCAATGTTGAGTCTACTCGAGTAGACTCAACATTGACCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145238.2-1786s1c1
Sequence:CCGGCCTTCAACCTTGTGTCCTAAACTCGAGTTTAGGACACAAGGTTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145238.2-730s1c1
Sequence:CCGGCCAAGTAATACCTCCGAGAAACTCGAGTTTCTCGGAGGTATTACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145238.2-2851s1c1
Sequence:CCGGCGTGACCGTTCTAACCTCATTCTCGAGAATGAGGTTAGAACGGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177758
ZSCAN20 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 20
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177758.4-3575s21c1
Sequence:CCGGTGAGGCAGATGGGTGATATTGCTCGAGCAATATCACCCATCTGCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177758.4-2186s21c1
Sequence:CCGGGAGGACCATGTGAACGGAAATCTCGAGATTTCCGTTCACATGGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177758.4-2688s21c1
Sequence:CCGGGTGCTCACTGGAGACGAAATTCTCGAGAATTTCGTCTCCAGTGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177758.3-2030s1c1
Sequence:CCGGCCGGGTAATTTGGAAGTGAATCTCGAGATTCACTTCCAAATTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177758.3-720s1c1
Sequence:CCGGCTGGCGCCTTATCAAGATATACTCGAGTATATCTTGATAAGGCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177758.3-953s1c1
Sequence:CCGGCGGACCCATTCAAGTGAGAAACTCGAGTTTCTCACTTGAATGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177758.3-1769s1c1
Sequence:CCGGCTCATCATTCACCAGCGGATTCTCGAGAATCCGCTGGTGAATGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177758.3-392s1c1
Sequence:CCGGCGCTACCGATTCAAGAACCTTCTCGAGAAGGTTCTTGAATCGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177758
ZSCAN20 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 20
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177758.4-3575s21c1
Sequence:CCGGTGAGGCAGATGGGTGATATTGCTCGAGCAATATCACCCATCTGCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177758.4-2186s21c1
Sequence:CCGGGAGGACCATGTGAACGGAAATCTCGAGATTTCCGTTCACATGGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177758.4-2688s21c1
Sequence:CCGGGTGCTCACTGGAGACGAAATTCTCGAGAATTTCGTCTCCAGTGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177758.3-2030s1c1
Sequence:CCGGCCGGGTAATTTGGAAGTGAATCTCGAGATTCACTTCCAAATTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177758.3-720s1c1
Sequence:CCGGCTGGCGCCTTATCAAGATATACTCGAGTATATCTTGATAAGGCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177758.3-953s1c1
Sequence:CCGGCGGACCCATTCAAGTGAGAAACTCGAGTTTCTCACTTGAATGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177758.3-1769s1c1
Sequence:CCGGCTCATCATTCACCAGCGGATTCTCGAGAATCCGCTGGTGAATGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177758.3-392s1c1
Sequence:CCGGCGCTACCGATTCAAGAACCTTCTCGAGAAGGTTCTTGAATCGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177758
ZSCAN20 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 20
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177758.4-3575s21c1
Sequence:CCGGTGAGGCAGATGGGTGATATTGCTCGAGCAATATCACCCATCTGCCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177758.4-2186s21c1
Sequence:CCGGGAGGACCATGTGAACGGAAATCTCGAGATTTCCGTTCACATGGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177758.4-2688s21c1
Sequence:CCGGGTGCTCACTGGAGACGAAATTCTCGAGAATTTCGTCTCCAGTGAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084638    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177758.3-2030s1c1
Sequence:CCGGCCGGGTAATTTGGAAGTGAATCTCGAGATTCACTTCCAAATTACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177758.3-720s1c1
Sequence:CCGGCTGGCGCCTTATCAAGATATACTCGAGTATATCTTGATAAGGCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177758.3-953s1c1
Sequence:CCGGCGGACCCATTCAAGTGAGAAACTCGAGTTTCTCACTTGAATGGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177758.3-1769s1c1
Sequence:CCGGCTCATCATTCACCAGCGGATTCTCGAGAATCCGCTGGTGAATGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177758.3-392s1c1
Sequence:CCGGCGCTACCGATTCAAGAACCTTCTCGAGAAGGTTCTTGAATCGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks