EMAIL THIS PAGE TO A FRIEND

ZSCAN21

zinc finger and SCAN domain containing 21

Synonyms: NY-REN-21 ZNF38 Zipro1
UniProtKB ID: Q9Y5A6, A4D2A6, D6W5T9, Q9H0B5
Gene ID:
Mouse(22697) zinc finger and SCAN domain containing 21
Rat(304342) zinc finger and SCAN domain containing 21
naked mole-rat(101697311) zinc finger and SCAN domain containing 21
domestic guinea pig(100733882) zinc finger and SCAN domain containing 21
cow(527103) zinc finger and SCAN domain containing 21
sheep(101111419) zinc finger and SCAN domain containing 21
domestic cat(101097939) zinc finger and SCAN domain containing 21
dog(489848) zinc finger and SCAN domain containing 21
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145914 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011757 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011757 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011757 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU026401 MISSION® esiRNA esiRNA targeting mouse Zscan21 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145914 Rosetta Predictions human pricing
NM_001012021 Rosetta Predictions rat pricing
XM_573375 Rosetta Predictions rat pricing
NM_001044703 Rosetta Predictions mouse pricing
NM_001044704 Rosetta Predictions mouse pricing
NM_001044705 Rosetta Predictions mouse pricing
NM_011757 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013281 predicted 289
2 SASI_Hs01_00013282 predicted 810
3 SASI_Hs01_00013284 predicted 1644
4 SASI_Hs01_00013285 predicted 1657
5 SASI_Hs01_00013286 predicted 1212
6 SASI_Hs01_00013287 predicted 843
7 SASI_Hs01_00013288 predicted 1491
8 SASI_Hs01_00013289 predicted 819
9 SASI_Hs01_00013290 predicted 1487
10 SASI_Hs02_00365451 predicted 1133
11 SASI_Hs01_00013283 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104695 predicted 590
2 SASI_Rn01_00104696 predicted 1627
3 SASI_Rn01_00104697 predicted 1069
4 SASI_Rn02_00200107 predicted 916
5 SASI_Rn01_00104698 predicted 1678
6 SASI_Rn01_00104699 predicted 352
7 SASI_Rn01_00104700 predicted 1029
8 SASI_Rn01_00104701 predicted 1009
9 SASI_Rn01_00104702 predicted 1470
10 SASI_Rn01_00104703 predicted 1845
11 SASI_Rn01_00104704 predicted 1840
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139957 predicted 639
2 SASI_Rn01_00139958 predicted 1674
3 SASI_Rn01_00139959 predicted 1115
4 SASI_Rn01_00139960 predicted 1725
5 SASI_Rn01_00139961 predicted 398
6 SASI_Rn01_00139962 predicted 1070
7 SASI_Rn01_00139963 predicted 1061
8 SASI_Rn01_00139964 predicted 1522
9 SASI_Rn01_00139965 predicted 1888
10 SASI_Rn01_00139966 predicted 1878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291334 predicted 441
2 SASI_Mm02_00291335 predicted 1753
3 SASI_Mm02_00291336 predicted 1254
4 SASI_Mm02_00291337 predicted 1302
5 SASI_Mm02_00291338 predicted 1144
6 SASI_Mm02_00291339 predicted 429
7 SASI_Mm02_00291340 predicted 1878
8 SASI_Mm02_00291341 predicted 990
9 SASI_Mm02_00291342 predicted 1919
10 SASI_Mm02_00291343 predicted 1546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291344 predicted 510
2 SASI_Mm02_00291345 predicted 1819
3 SASI_Mm02_00291346 predicted 1319
4 SASI_Mm02_00291347 predicted 1372
5 SASI_Mm02_00291348 predicted 1216
6 SASI_Mm02_00291349 predicted 490
7 SASI_Mm02_00291350 predicted 1945
8 SASI_Mm02_00291351 predicted 1056
9 SASI_Mm02_00291352 predicted 1982
10 SASI_Mm02_00291353 predicted 1615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291354 predicted 419
2 SASI_Mm02_00291355 predicted 1733
3 SASI_Mm02_00291356 predicted 1234
4 SASI_Mm02_00291357 predicted 1285
5 SASI_Mm02_00291358 predicted 1127
6 SASI_Mm02_00291359 predicted 406
7 SASI_Mm02_00291360 predicted 1866
8 SASI_Mm02_00291361 predicted 972
9 SASI_Mm02_00291362 predicted 1905
10 SASI_Mm02_00291363 predicted 1533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139077 predicted 527
2 SASI_Mm01_00139078 predicted 1840
3 SASI_Mm01_00139079 predicted 1335
4 SASI_Mm01_00139080 predicted 1387
5 SASI_Mm01_00139081 predicted 1236
6 SASI_Mm01_00139082 predicted 515
7 SASI_Mm02_00321355 predicted 1972
8 SASI_Mm01_00139083 predicted 1075
9 SASI_Mm01_00139084 predicted 2001
10 SASI_Mm01_00139085 predicted 1636
11 SASI_Mm01_00139086 predicted 1771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145914
VALIDATED
ZSCAN21 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 21
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145914.2-647s1c1
Sequence:CCGGCCAGTCACAAATACGAGTCTTCTCGAGAAGACTCGTATTTGTGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_145914.2-718s1c1
Sequence:CCGGGATCCAAGAAAGGTCCGAGATCTCGAGATCTCGGACCTTTCTTGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145914.2-1835s1c1
Sequence:CCGGGCGTAGTTAAACAGACGTGTACTCGAGTACACGTCTGTTTAACTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145914.2-593s1c1
Sequence:CCGGCCTCAGGAACTGCAAAGGAATCTCGAGATTCCTTTGCAGTTCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_145914.2-1422s1c1
Sequence:CCGGCCACAGCTCCAACTTCAATAACTCGAGTTATTGAAGTTGGAGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145914.2-718s21c1
Sequence:CCGGGATCCAAGAAAGGTCCGAGATCTCGAGATCTCGGACCTTTCTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145914.2-852s21c1
Sequence:CCGGCTTAGAGAGGCAGTGCGTAAACTCGAGTTTACGCACTGCCTCTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145914.2-1422s21c1
Sequence:CCGGCCACAGCTCCAACTTCAATAACTCGAGTTATTGAAGTTGGAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145914.2-820s21c1
Sequence:CCGGTCTGTGATTATCGCCAATAAACTCGAGTTTATTGGCGATAATCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145914.2-958s21c1
Sequence:CCGGCCAGGAGAGAGACGTTATATACTCGAGTATATAACGTCTCTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145914
VALIDATED
ZSCAN21 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 21
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145914.2-647s1c1
Sequence:CCGGCCAGTCACAAATACGAGTCTTCTCGAGAAGACTCGTATTTGTGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_145914.2-718s1c1
Sequence:CCGGGATCCAAGAAAGGTCCGAGATCTCGAGATCTCGGACCTTTCTTGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145914.2-1835s1c1
Sequence:CCGGGCGTAGTTAAACAGACGTGTACTCGAGTACACGTCTGTTTAACTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145914.2-593s1c1
Sequence:CCGGCCTCAGGAACTGCAAAGGAATCTCGAGATTCCTTTGCAGTTCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_145914.2-1422s1c1
Sequence:CCGGCCACAGCTCCAACTTCAATAACTCGAGTTATTGAAGTTGGAGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145914.2-718s21c1
Sequence:CCGGGATCCAAGAAAGGTCCGAGATCTCGAGATCTCGGACCTTTCTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145914.2-852s21c1
Sequence:CCGGCTTAGAGAGGCAGTGCGTAAACTCGAGTTTACGCACTGCCTCTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145914.2-1422s21c1
Sequence:CCGGCCACAGCTCCAACTTCAATAACTCGAGTTATTGAAGTTGGAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145914.2-820s21c1
Sequence:CCGGTCTGTGATTATCGCCAATAAACTCGAGTTTATTGGCGATAATCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145914.2-958s21c1
Sequence:CCGGCCAGGAGAGAGACGTTATATACTCGAGTATATAACGTCTCTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145914
VALIDATED
ZSCAN21 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 21
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145914.2-647s1c1
Sequence:CCGGCCAGTCACAAATACGAGTCTTCTCGAGAAGACTCGTATTTGTGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_145914.2-718s1c1
Sequence:CCGGGATCCAAGAAAGGTCCGAGATCTCGAGATCTCGGACCTTTCTTGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145914.2-1835s1c1
Sequence:CCGGGCGTAGTTAAACAGACGTGTACTCGAGTACACGTCTGTTTAACTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145914.2-593s1c1
Sequence:CCGGCCTCAGGAACTGCAAAGGAATCTCGAGATTCCTTTGCAGTTCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_145914.2-1422s1c1
Sequence:CCGGCCACAGCTCCAACTTCAATAACTCGAGTTATTGAAGTTGGAGCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145914.2-718s21c1
Sequence:CCGGGATCCAAGAAAGGTCCGAGATCTCGAGATCTCGGACCTTTCTTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145914.2-852s21c1
Sequence:CCGGCTTAGAGAGGCAGTGCGTAAACTCGAGTTTACGCACTGCCTCTCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145914.2-1422s21c1
Sequence:CCGGCCACAGCTCCAACTTCAATAACTCGAGTTATTGAAGTTGGAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145914.2-820s21c1
Sequence:CCGGTCTGTGATTATCGCCAATAAACTCGAGTTTATTGGCGATAATCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_145914.2-958s21c1
Sequence:CCGGCCAGGAGAGAGACGTTATATACTCGAGTATATAACGTCTCTCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011757
VALIDATED
ZSCAN21 MISSION shRNA Bacterial Glycerol Stock
zinc finger and SCAN domain containing 21
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011757.1-2642s1c1
Sequence:CCGGCGTCTGTTGTTCTCGTTGTAACTCGAGTTACAACGAGAACAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011757.1-2158s1c1
Sequence:CCGGGCTCCAACCTTACCCTTCATTCTCGAGAATGAAGGGTAAGGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011757.1-1894s1c1
Sequence:CCGGCCAATAAGTATGGGTCACGGTCTCGAGACCGTGACCCATACTTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011757.1-1963s1c1
Sequence:CCGGCCTCTCTTCAAGACACAGGTTCTCGAGAACCTGTGTCTTGAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011757.1-1695s1c1
Sequence:CCGGGCCAGCCCTAAATATGAGTTTCTCGAGAAACTCATATTTAGGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011757.2-1635s21c1
Sequence:CCGGGCAGCCTCATTCGACACTATCCTCGAGGATAGTGTCGAATGAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011757.2-563s21c1
Sequence:CCGGTTGGGACCTTCGACCATTAAACTCGAGTTTAATGGTCGAAGGTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011757.2-446s21c1
Sequence:CCGGATGGGTCCTTCGACCATTAAACTCGAGTTTAATGGTCGAAGGACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011757.2-311s21c1
Sequence:CCGGAGGCCACCTCAGGAATCTATGCTCGAGCATAGATTCCTGAGGTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011757.2-957s21c1
Sequence:CCGGGAACGGCAATGGAGTCCTTAACTCGAGTTAAGGACTCCATTGCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011757.2-385s21c1
Sequence:CCGGTACCCTAGAGCTATCCCATAACTCGAGTTATGGGATAGCTCTAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011757
VALIDATED
ZSCAN21 MISSION shRNA shRNA Plasmid DNA
zinc finger and SCAN domain containing 21
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011757.1-2642s1c1
Sequence:CCGGCGTCTGTTGTTCTCGTTGTAACTCGAGTTACAACGAGAACAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011757.1-2158s1c1
Sequence:CCGGGCTCCAACCTTACCCTTCATTCTCGAGAATGAAGGGTAAGGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011757.1-1894s1c1
Sequence:CCGGCCAATAAGTATGGGTCACGGTCTCGAGACCGTGACCCATACTTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011757.1-1963s1c1
Sequence:CCGGCCTCTCTTCAAGACACAGGTTCTCGAGAACCTGTGTCTTGAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011757.1-1695s1c1
Sequence:CCGGGCCAGCCCTAAATATGAGTTTCTCGAGAAACTCATATTTAGGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011757.2-1635s21c1
Sequence:CCGGGCAGCCTCATTCGACACTATCCTCGAGGATAGTGTCGAATGAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011757.2-563s21c1
Sequence:CCGGTTGGGACCTTCGACCATTAAACTCGAGTTTAATGGTCGAAGGTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011757.2-446s21c1
Sequence:CCGGATGGGTCCTTCGACCATTAAACTCGAGTTTAATGGTCGAAGGACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011757.2-311s21c1
Sequence:CCGGAGGCCACCTCAGGAATCTATGCTCGAGCATAGATTCCTGAGGTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011757.2-957s21c1
Sequence:CCGGGAACGGCAATGGAGTCCTTAACTCGAGTTAAGGACTCCATTGCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011757.2-385s21c1
Sequence:CCGGTACCCTAGAGCTATCCCATAACTCGAGTTATGGGATAGCTCTAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011757
VALIDATED
ZSCAN21 MISSION shRNA Lentiviral Transduction Particles
zinc finger and SCAN domain containing 21
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011757.1-2642s1c1
Sequence:CCGGCGTCTGTTGTTCTCGTTGTAACTCGAGTTACAACGAGAACAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011757.1-2158s1c1
Sequence:CCGGGCTCCAACCTTACCCTTCATTCTCGAGAATGAAGGGTAAGGTTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011757.1-1894s1c1
Sequence:CCGGCCAATAAGTATGGGTCACGGTCTCGAGACCGTGACCCATACTTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011757.1-1963s1c1
Sequence:CCGGCCTCTCTTCAAGACACAGGTTCTCGAGAACCTGTGTCTTGAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011757.1-1695s1c1
Sequence:CCGGGCCAGCCCTAAATATGAGTTTCTCGAGAAACTCATATTTAGGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011757.2-1635s21c1
Sequence:CCGGGCAGCCTCATTCGACACTATCCTCGAGGATAGTGTCGAATGAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011757.2-563s21c1
Sequence:CCGGTTGGGACCTTCGACCATTAAACTCGAGTTTAATGGTCGAAGGTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011757.2-446s21c1
Sequence:CCGGATGGGTCCTTCGACCATTAAACTCGAGTTTAATGGTCGAAGGACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011757.2-311s21c1
Sequence:CCGGAGGCCACCTCAGGAATCTATGCTCGAGCATAGATTCCTGAGGTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011757.2-957s21c1
Sequence:CCGGGAACGGCAATGGAGTCCTTAACTCGAGTTAAGGACTCCATTGCCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011757.2-385s21c1
Sequence:CCGGTACCCTAGAGCTATCCCATAACTCGAGTTATGGGATAGCTCTAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks